This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, R. A.
Right arrow Articles by Cullen, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, R. A.
Right arrow Articles by Cullen, B. R.

 Previous Article  |  Next Article 

Journal of Virology, July 2005, p. 8724-8731, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.8724-8731.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Foamy Virus Bet Proteins Function as Novel Inhibitors of the APOBEC3 Family of Innate Antiretroviral Defense Factors

Rebecca A. Russell,1,{dagger} Heather L. Wiegand,2,{dagger} Michael D. Moore,1 Alexandra Schäfer,2 Myra O. McClure,1 and Bryan R. Cullen2*

Jefferiss Trust Laboratories, Wright-Fleming Institute, Imperial College, London W2 1PG, United Kingdom,1 Center for Virology and Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 277102

Received 7 February 2005/ Accepted 30 March 2005


arrow
ABSTRACT
 
Foamy viruses are a family of complex retroviruses that establish common, productive infections in a wide range of nonhuman primates. In contrast, humans appear nonpermissive for foamy virus replication, although zoonotic infections do occur. Here we have analyzed the ability of primate and mouse APOBEC3G proteins to inhibit the infectivity of primate foamy virus (PFV) virions produced in their presence. We demonstrate that several APOBEC3 proteins can potently inhibit the infectivity of a PFV-based viral vector. This inhibition correlated with the packaging of inhibitory APOBEC3 proteins into PFV virions, due to a specific PFV Gag/APOBEC3 interaction, and resulted in the G to A hypermutation of PFV reverse transcripts. While inhibition of PFV virion infectivity by primate APOBEC3 proteins was largely relieved by coexpression of the PFV Bet protein, a cytoplasmic auxiliary protein of previously uncertain function, Bet failed to relieve inhibition caused by murine APOBEC3. PFV Bet bound to human, but not mouse, APOBEC3 proteins in coexpressing cells, and this binding correlated with the specific inhibition of their incorporation into PFV virions. Of note, both PFV Bet and a second Bet protein, derived from an African green monkey foamy virus, rescued the infectivity of Vif-deficient human immunodeficiency virus type 1 (HIV-1) virions produced in the presence of African green monkey APOBEC3G and blocked the incorporation of this host factor into HIV-1 virion particles. However, neither foamy virus Bet protein reduced APOBEC3 protein expression levels in virion producer cells. While these data identify the foamy virus Bet protein as a functional ortholog of the HIV-1 Vif auxiliary protein, they also indicate that Vif and Bet block APOBEC3 protein function by distinct mechanisms.


arrow
INTRODUCTION
 
It has recently become evident that humans and other mammals encode a range of proteins that can confer intrinsic immunity to infection by retroviruses (reviewed in reference 13). For example, the human innate antiretroviral defense factors APOBEC3G (hA3G) and APOBEC3F (hA3F) function as potent inhibitors of human immunodeficiency virus type 1 (HIV-1) variants that lack a functional vif gene (3, 20, 34, 38, 40). In the absence of Vif (virion infectivity factor), both hA3G and hA3F are packaged into progeny HIV-1 virions, where they inhibit subsequent infection by extensively editing deoxycytidine residues to deoxyuridine on the DNA minus strand during reverse transcription (14, 23, 42, 45). These C-to-U changes result in G-to-A mutations in the DNA plus strand, which in turn leads either to destabilization of reverse transcripts or the production of defective viral proteins. Vif prevents this by binding to hA3G and hA3F and targeting these proteins for proteasomal degradation (8, 17, 22, 25-27, 35, 38, 40, 43). Interestingly, the protective action of Vif is species specific (36). Thus, while HIV-1 Vif can protect against hA3G and chimpanzee APOBEC3 (cpzA3G), it is far less effective at protecting HIV-1 against the inhibitory effect of African green monkey APOBEC3G (agmA3G) (5, 24, 25, 32). Moreover, mouse APOBEC3 (mA3) strongly inhibits HIV-1 infectivity yet is resistant to all primate lentiviral Vif proteins analyzed so far (3, 23, 25, 40). The inability of certain Vif proteins to neutralize specific APOBEC3 proteins correlates with their inability to bind these proteins in vivo (5, 25, 32, 40).

While the interaction of human APOBEC3 proteins with human and other primate lentiviruses has been the subject of considerable study, relatively little is known about how other retroviruses deal with these host resistance factors. However, it has been reported that the simple retrovirus murine leukemia virus (MLV) is strongly inhibited by hA3G but resistant to inhibition by the cognate mA3 protein (3, 11, 19). This resistance pattern correlated with the packaging of hA3G, but not mA3, into MLV virion particles.

In this report, we have asked whether primate foamy viruses (PFVs) are sensitive to inhibition by different vertebrate APOBEC3 proteins. Foamy viruses are a ubiquitous family of complex retroviruses that can establish low-level, productive infections in many mammals, including nonhuman primates (21). While several zoonotic human infections have been documented, these appear to be self-limiting, and no human-to-human transmission has been observed so far (16, 33, 41). Indeed, while the prototypic PFV proviral clone was originally recovered from cultured human cells, this virus is closely related to chimpanzee foamy viruses and therefore may derive from a zoonotic transmission (1, 12, 21).

Like HIV-1, PFV is a complex retrovirus that encodes not only the canonical retroviral structural proteins Gag, Pol, and Env but also a nuclear transcriptional transactivator, termed Tas, and at least one auxiliary protein, termed Bet (21). While Bet is found in vast amounts in the cytoplasm of infected cells (9), its function has remained uncertain (21), although expression of Bet has been reported to render cells resistant to PFV infection (4). Using infectious, replication-defective PFV-based vectors, we now demonstrate that PFV infectivity is strongly inhibited by the expression in producer cells of hA3G, hA3F, mA3, and, to a lesser extent, cpzA3G, but not by human APOBEC3A (hA3A). Surprisingly, inhibition by hA3G, hA3F, and cpzA3G, but not mA3, could be largely rescued by expression in trans of not only HIV-1 Vif but also PFV Bet. PFV is shown to package the hA3G, hA3F, cpzA3G, and mA3 proteins into progeny virions due to a specific interaction with the PFV Gag protein. After packaging, the incorporated APOBEC3 proteins induce extensive G to A mutagenesis of newly synthesized PFV proviral DNA. The PFV Bet protein specifically interacts with hA3G and hA3F but not with mA3 and inhibited the incorporation of the hA3G, hA3F, and cpzA3G proteins into progeny PFV virions. Moreover, both PFV Bet and a Bet protein derived from simian foamy virus 3 (SFV-3), an African green monkey foamy virus (29), proved able to inhibit incorporation of agmA3G into HIV-1 virion particles and partially rescued the infectivity of HIV-1 virions produced in the presence of agmA3G. While Bet therefore functions as the foamy virus ortholog of HIV-1 Vif, we failed to detect any decrease in cellular hA3G or hA3F expression in the presence of either PFV or SFV-3 Bet. Thus, Bet appears to inhibit the antiretroviral activity of human APOBEC3 proteins by a novel mechanism.


arrow
MATERIALS AND METHODS
 
Plasmid construction. The HIV-1 proviral expression plasmids pNL-HXB-LUC{Delta}VIF and pNL4-3{Delta}VIF{Delta}ENV have been previously described (5, 40), as have the PFV-derived vector plasmids pMH71, pCZHFVenv, pCZIgag-2, pCZIpol, and pMD9 (15, 28). pMD9-luc was modified from pMD9 by replacing the green fluorescent protein (gfp) indicator gene with the firefly luciferase (luc) gene. Similarly, pMH71-lacZ was generated from pMH71 by substituting the ß-galactosidase gene in place of the gfp gene. All APOBEC3 and Vif expression plasmids have been described previously (5, 25, 40), as has the ß-arrestin2 (ßarr2) expression plasmid pßarr2-HA (31, 40). The PFV Bet expression plasmid, pBet-PFV, was constructed by insertion of the genomic bet gene from PFV (12) into pcDNA3.1. Similarly, the SFV-3 Bet expression plasmid pBet-AGM was constructed by insertion of the genomic bet gene from SFV-3 (29) into pcDNA3.1.

Plasmids expressing the full-length HIV-1 or PFV Gag protein fused to a carboxy-terminal glutathione S-transferase (GST) moiety were derived from the pK expression plasmid (6) by sequential insertion of the GST gene as a BamHI/NotI fragment, followed by insertion of a codon-optimized form of the HIV-1 gag gene or the wild-type PFV gag gene as a HindIII/BamHI fragment.

Cell culture, transfections, and transductions. The cell lines 293T, HT1080, and D17 were maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 1% penicillin and streptomycin, and 1% L-glutamine.

To assess the level of APOBEC3-induced inhibition of PFV infectivity, 293T cells (35 mm plates) were transfected with 800 ng each of pCZIgag-2, pCZIpol, pCZHFVenv, and pMD9-luc together with 125 ng of an APOBEC expression plasmid or the pcDNA3.1 control plasmid. After 2 days, the virus containing supernatant media were filtered and used to infect HT1080 cells. An additional 48 h later, the HT1080 cells were harvested and lysed, and luciferase activities were determined.

To determine if the APOBEC3-induced inhibition of PFV infectivity could be rescued by HIV-1 Vif or PFV Bet, 293T cells were transfected with 2 µg of pMH71 or pMH71-lacZ, 1 µg of pCZHFVenv, 75 ng of the relevant APOBEC3 expression plasmid, 500 ng of either pgVif or pg{Delta}Vif, or 925 ng of the control plasmid pcDNA3.1 or pBet-PFV. After 48 h the vector-containing supernatants were titrated on D17 cells.

The ability of the PFV and SFV-3 Bet proteins and of HIV-1 and SIVagmVif to rescue the inhibition of HIV-1 infectivity induced by the agmA3G protein was quantified as previously described (5). Briefly, 293T cells were transfected with 2.5 µg of pNL-HXB-LUC{Delta}VIF, 800 ng of a Vif or Bet expression plasmid, and 200 ng of the agmA3G expression plasmid. The parental pcDNA3.1 expression plasmid served as a control. Two days later, the supernatant media were harvested, filtered, and used to infect susceptible cells. A further 28 h later, the infected cells were lysed and induced luciferase activities were quantified.

APOBEC3 packaging analysis. Forty-eight hours after transfection of 293T cells (100 mm plates) with 24 µg pMH71, 13.5 µg pCZHFVenv, 1 µg of a plasmid expressing hemagglutinin (HA)-tagged hA3F, hA3G, mA3, or ßarr2, and 12.5 µg of either pBet-PFV or pcDNA3.1 vector-containing supernatants (16 ml) were harvested, filtered (0.45 µm), and layered onto a 2-ml 20% (wt/vol) sucrose cushion in phosphate-buffered saline. Virus particles were pelleted by centrifugation at 29,000 rpm for 90 min at 4°C in a Sorvall AH-629 rotor. Supernatants were also harvested from cells transfected with pMH71 only, pBet-PFV only, pMH71 and pBet-PFV, or the hA3G-expression plasmid only. Pellets were resuspended in 20 µl loading buffer (250 mM Tris, pH 6.8, 4% sodium dodecyl sulfate [SDS], 10% glycerol, 2% ß-mercaptoethanol, 0.006% bromophenol blue). An aliquot of 2 x 106 producer cells was also harvested, resuspended in 50 µl lysis buffer (50 mM Tris, pH 8, 150 mM NaCl, 10% glycerol, 0.5% Triton X-100, 2 mM protease inhibitor cocktail), and incubated at 4°C for 20 min. A 50-µl aliquot of loading buffer was added to the cells and all the samples analyzed by SDS-polyacrylamide gel electrophoresis, followed by Western analysis using either a mouse anti-HA monoclonal (Covance) or a human anti-PFV serum. Immunoblots were developed using the metal-enhanced DAB substrate kit (Pierce).

Packaging of agmA3G into HIV-1 virion particles was analyzed as previously described (5, 40) using the same transfection conditions given above for analysis of the effect of PFV and SFV-3 Bet on HIV-1 virion infectivity, except that cells were transfected with pNL4-3{Delta}VIF{Delta}ENV in place of pNL-HXB-LUC{Delta}VIF.

Coprecipitation of APOBEC3 proteins with foamy virus Gag or Bet. Coimmunoprecipitation of HA-epitope-tagged versions of hA3G, hA3F, or mA3 with PFV Bet was performed as previously described (5, 40). Briefly, 293T cells were cotransfected with 500 ng of pBet-PFV and 500 ng of a APOBEC3 protein expression plasmid. The parental pcDNA3.1 plasmid was used as a negative control. At 48 h after transfection, cells were lysed in 250 µl of lysis buffer and a 50-µl aliquot was retained for analysis of input protein levels. The remaining 200 µl was subjected to immunoprecipitation using an HA-specific monoclonal antibody. Recovered proteins were subjected to Western analysis using rabbit polyclonal antisera specific for the HA-tag or the PFV Bet protein.

In vivo binding of PFV Bet to HIV-1 or PFV Gag was detected by cotransfection of 293T cells with 1.5 µg of a plasmid encoding wild-type GST or the HIV-1 GAG-GST or PFV GAG-GST fusion protein, together with 1.5 µg of a plasmid expressing HA-epitope-tagged hA3G or ßarr2. At 48 h posttransfection, the cells were lysed in 250 µl of lysis buffer and a 50-µl aliquot was retained for analysis of input proteins. The remaining lysate was incubated with glutathione-Sepharose beads for 1 h. The beads were then washed extensively, and the input and bound proteins were detected by Western analysis using monoclonal antibodies specific for the HA-epitope tag or the GST tag (Santa Cruz).

Hypermutation of PFV proviral DNA by hA3G and hA3F. PFV vector made in the presence of 250 ng of either hA3F or hA3G was harvested, filtered (0.45 µm), and added to fresh 293T cells. After 12 h the cells were harvested and washed, and total DNA was isolated. To remove any plasmid contamination, the isolated DNA (~20 µg) was digested with 40 U of DpnI (New England Biolabs) for 2 h. Following heat inactivation of the DpnI, a 600-bp region of the eGFP gene containing two DpnI sites was amplified by PCR using Easy-A High-fidelity PCR cloning enzyme (Stratagene) with the following reaction conditions: 50 µl DpnI digested sample, 1x Easy-A reaction buffer, 100 mM deoxynucleoside triphosphates, 200 ng forward primer (5'CTGGACGGCGACGTAACGGCC3'), 200 ng reverse primer (5'GAACTCCAGCAGGACCATGTG3'), and 10 U Easy-A high fidelity PCR cloning enzyme. After 40 cycles of 30 s of denaturation at 95°C, 30 s of primer annealing at 55°C, and 45 s of extension at 72°C, the resulting PCR product was cloned into the TA-cloning vector (Invitrogen) and sequenced.


arrow
RESULTS
 
Several APOBEC3 proteins can inhibit PFV infectivity. Several members of the human APOBEC3 family of proteins, as well as their rodent and primate homologues, inhibit Vif-deficient HIV-1 replication (3, 20, 34, 40, 46). To test whether these proteins could also inhibit PFV infectivity, the infectious titer of PFV virions produced in the presence or absence of human APOBEC3C (hA3C), hA3A, hA3F, hA3G, cpzA3G, or mA3 was determined by cotransfection of 293T cells with the pMD9-luc foamy virus indicator vector together with plasmids expressing PFV Gag, Pol, and Env but not Tas or Bet (15), and finally with plasmids expressing the various APOBEC3 proteins (25, 40). After 48 h, virions released from the transfected cells were used to infect HT1080 cells, and, a further 48 h later, induced luciferase activities quantitated. As shown in Fig. 1 (upper panel), PFV infectivity was profoundly inhibited (≥10-fold) by hA3F, hA3G, and mA3 but was not affected by hA3A. hA3C and cpzA3G displayed an intermediate phenotype, with hA3C inhibiting PFV infectivity by ~60% while cpzA3G inhibited PFV infectivity by ~70%. These differences did not appear to reflect significant differences in APOBEC3 protein expression levels, although somewhat lower levels of expression of cpzA3G were detected (Fig. 1, lower panel). We note that this is the same pattern of inhibition previously observed with Vif-deficient HIV-1, except that cpzA3G has been reported to be a potent inhibitor of Vif-deficient HIV-1 infectivity (3, 25, 40).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. PFV virion infectivity is inhibited by specific APOBEC3 proteins. 293T cells were transfected with the PFV vector plasmids pMD9-luc, pCZHFVenv, pCZIgag-2, and pCZIpol together with plasmids expressing the indicated APOBEC3 proteins or the parental pcDNA3.1 plasmid as a control. At 48 h posttransfection, the supernatants were harvested, filtered, and used to infect HT1080 cells. A further 48 h later, the infected cells were lysed and induced luciferase activities were quantitated. The data shown are plotted as a percentage of the level of luciferase detected in HT1080 cells infected by PFV virions produced in the absence of an APOBEC3 protein (control). Averages of three experiments with standard deviations are indicated. APOBEC3 protein expression was confirmed by Western blot using an HA epitope-specific antiserum. The slightly more rapid migration of cpzA3G is due to the presence of only a single HA epitope tag while all the other proteins contain three tandem HA epitope tags.

hA3G and hA3F induce hypermutation of PFV vector sequences. The antiretroviral activity of hA3G and hA3F is at least in part due to the deamination of deoxycytidine to deoxyuridine on the nascent minus strand DNA during reverse transcription, which in turn leads to G to A hypermutation of the DNA plus strand (14, 23, 42, 45). Hepatitis B virus (HBV) is also inhibited by hA3G, but G to A mutations are rare and only occur in certain cell types (30, 39). The inhibitory activity of hA3G on HBV infectivity instead appears to be primarily due to inhibition of pregenomic RNA packaging into viral particles. PFV shares some characteristics with the hepadnaviruses (21), and therefore the APOBEC3 proteins could be inhibiting PFV infectivity by either means.

To address the mechanism of inhibition of PFV infectivity by APOBEC3 proteins, a 600-bp region of the eGFP gene, obtained from cells transduced with the pMH71 PFV vector made in the presence of either hA3G or hA3F, was sequenced. For hA3G, 49 G to A mutations were seen out of a total of 4,973 bases sequenced, of which 1,421 were predicted to be G residues, a mutation rate of ~3.4%. For hA3F, 59 G to A mutations were seen out of a total of 2,440 bases sequenced, of which 620 were predicted to be G residues, a mutation rate of ~9.5%. A sample 100-bp region showing six hA3G-edited sequences and three hA3F-edited sequences is shown in Fig. 2. The same region sequenced from PFV virions made in the absence of any APOBEC3 protein contained only two G to A mutations out of a total of 1,450 bases sequences, of which 375 were predicted to be G residues, a mutation rate of ~0.5% (data not shown). As well as the aforementioned G to A mutations, eight other (presumably irrelevant) point mutations were seen in hA3G-mutated DNA and one additional mutation in both hA3F-mutated DNA and in the PFV proviral DNA produced in the absence of either APOBEC3 protein. Based on these data, we conclude that inhibition of PFV infectivity by hA3G and hA3F is likely due to the same mechanism previously reported for inhibition of Vif-deficient HIV-1 (14, 23, 42, 45).



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 2. hA3G and hA3F induce G to A hypermutation of PFV proviruses. 293T cells were transfected with the PFV vector plasmids pMH71 and pCZHFVenv and either an hA3G or an hA3F expression plasmid. At 48 h posttransfection, the supernatant media were used to infect 293T cells and the sequences of reverse transcripts were determined 12 h later. A representative 100-bp section of the eGFP gene (from nucleotides 570 to 670), with six sequences obtained from hA3G-expressing cells and three from hA3F, is shown. Only mutated based are indicated, a dash indicates sequence identity. G's are bolded.

APOBEC3-mediated inhibition of PFV infectivity is partially rescued by Bet. We next asked whether HIV-1 Vif or PFV Bet would rescue the knockdown of PFV virion infectivity observed in the presence of APOBEC3 proteins. To address this question, the infectious titer of PFV virions produced following cotransfection of 293T cells with hA3A, hA3F, hA3G, cpzA3G, or mA3, in the presence or absence of either HIV-1 Vif or PFV Bet, was measured. In accordance with previous data showing Vif specificity (3, 25, 40), Vif largely rescued PFV virion infectivity that had been inhibited by hA3F, hA3G, and cpzA3G, but not mA3 (Fig. 3). Like HIV-1 Vif, PFV Bet was also able to rescue PFV virion infectivity in a species-specific manner. Thus, Bet coexpression resulted in a significant enhancement in the infectivity of PFV virions produced in the presence of hA3G, hA3F, and particularly cpzA3G, while PFV Bet, like HIV-1 Vif, failed to enhance the infectivity of PFV virions produced in the presence of mA3. Interestingly, PFV Bet rescued hA3F-induced inhibition of PFV infectivity somewhat less efficiently than did HIV-1 Vif, thus demonstrating a degree of divergence between the APOBEC3 protein specificities of these two retroviral accessory proteins.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. Inhibition of PFV infectivity by hA3G, hA3F, and cpzA3G, but not mA3, can be rescued by PFV Bet. For Vif rescue, 293T cells were transfected with PFV vector plasmids, the indicated APOBEC3 expression plasmids, and either pgVif or pg{Delta}Vif. For Bet rescue, 293T cells were transfected with PFV vector plasmids, the indicated APOBEC3 expression plasmids, and either pBet-PFV or pcDNA3. At 48 h after transfection, the supernatant media were harvested, filtered, and titrated on D17 cells. The level of infectious vector particles, plotted as a percentage of the level obtained with hA3A, is shown for each of the indicated APOBEC3 proteins in the presence or absence of Vif or Bet. Average of three experiments with standard deviations are indicated.

APOBEC3 proteins are packaged into PFV virions due to a specific interaction with PFV Gag. It is well documented that inhibitory APOBEC3 proteins are specifically packaged into HIV-1 particles (5, 17, 25, 35, 40). The hypothesis that the same is also true for PFV was tested by Western blot of PFV virions produced in the presence of HA-tagged hA3A, hA3F, hA3G, cpzA3G, mA3, or of a control human cytoplasmic protein, ßarr2. The ability of PFV Bet to inhibit this packaging was also assessed. Following transfection of 293T cells with the relevant plasmids, virions present in the supernatant media as well as the producer cells were harvested and analyzed by Western blot with an anti-HA antibody or an anti-PFV antiserum. The nonspecific release of either HA-tagged proteins or PFV proteins into the supernatant media was controlled by including cells transfected with pMH71 only, pBet-PFV only, pMH71 and pBet-PFV together, or hA3G only.

Analysis of PFV virions produced in the presence of hA3F, hA3G, mA3, and cpzA3G indicated that all four of these APOBEC3 proteins are specifically packaged (Fig. 4, top panel, lanes 3, 5, 7, and 9, respectively). As no packaging of HA-tagged hA3A or ßarr2 was observed, and no band was detected in the hA3G only control (Fig. 4 top panel, lanes 1, 11, and 16, respectively), packaging was considered to be specific. The ability of PFV Bet to inhibit the packaging of hA3F, hA3G, and cpzA3G was demonstrated by a reduction in APOBEC3-specific bands in the analyzed virions (Fig. 4 top panel, lanes 4, 6, and 10, respectively). Quantification of the blot by scanning revealed that PFV Bet reduced hA3G and hA3F packaging into PFV virions by three- to fourfold while packaging of cpzA3G was reduced by more than fivefold. In contrast, packaging of mA3 into PFV virions was reduced by only ~1.4-fold (Fig. 4, compare lanes 7 and 8). The bottom three panels confirm that similar levels of the different APOBEC3 and PFV proteins were present in the producer cells and that the same level of released virions was analyzed in each case.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 4. Bet specifically inhibits virion packaging of hA3F, hA3G, and cpzA3G. 293T cells were transfected with the PFV vector plasmids pMH71 and pCZHFVenv, plasmids expressing HA-tagged forms of the indicated APOBEC3 proteins or the ßarr2 control, and either pBet-PFV or pcDNA3. As controls, 293T cells were transfected with pMH71 only, pBet-PFV only, pMH71, and pBet-PFV or the hA3G expression plasmid only. At 48 h after transfection, the supernatants were harvested and filtered, and PFV virion particles collected by ultracentrifugation. The lysed virion-producing cells and the virion lysates were then separated by SDS-polyacrylamide gel electrophoresis, and the APOBEC3 and PFV proteins were visualized by Western blot with either an anti-HA-specific mouse monoclonal antibody or an anti-PFV human serum. The different proteins, their sources, and their sizes are indicated, as are the antibodies used. APOBEC3 and Gag protein expression levels were quantified by scanning followed by analysis using Labimage version 2.7.

For APOBEC3 proteins to be specifically packaged into PFV vector particles, and for PFV Bet to inhibit this packaging, specific interactions between the APOBEC3 proteins and one or more PFV proteins are likely to occur. It has recently been shown that hA3G is packaged into HIV-1 virions via interactions with the nucleocapsid (NC) domain of Gag (2, 7, 31, 44). We therefore asked if PFV Gag would also specifically interact with hA3G in coexpressing cells. For this purpose, 293T cells were cotransfected with plasmids expressing HA-tagged hA3G and GST-tagged PFV Gag. Plasmids expressing the wild-type GST protein or an irrelevant HA-tagged human protein, ßarr2, served as negative controls, while GST-tagged HIV-1 Gag functioned as a positive control. After 48 h, the cells were lysed and subjected to incubation with glutathione-Sepharose beads. Bound proteins were detected by Western blot with anti-HA and anti-GST antibodies. As Fig. 5 shows, there is a readily detectable and specific interaction between PFV Gag and hA3G and, as previously reported (34-37), between HIV-1 Gag and hA3G. No binding of ßarr2 to PFV Gag or of GST to hA3G was observed. These data demonstrate that PFV Gag shares the ability of HIV-1 Gag to interact specifically with hA3G in coexpressing cells, despite the lack of any sequence homology between HIV-1 NC and the distinct PFV Gag protein. We therefore conclude that hA3G, and presumably also hA3F, mA3, and cpzA3G, are packaged into PFV virions due to a specific interaction with PFV Gag.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 5. The PFV Gag protein specifically interacts with hA3G. 293T cells were transfected with an expression plasmid encoding GST, HIV-1 GAG-GST, or PFV GAG-GST together with a plasmid encoding HA-tagged ßarr2 or HA-tagged hA3G, as indicated. At 48 h, the transfected cells were lysed and incubated with glutathione-Sepharose beads. Both input and bound fractions were analyzed by Western blot with either an anti-HA-antibody ({alpha}-HA) or an anti-GST antibody ({alpha}-GST).

PFV Bet binds human but not murine APOBEC3 proteins. We next asked whether PFV Bet, like HIV-1 Vif, was capable of binding to APOBEC3 proteins in vivo. To test this hypothesis, we cotransfected 293T cells with the PFV Bet expression plasmid pBet-PFV and plasmids expressing HA-tagged forms of hA3G, hA3F, and mA3. Forty-eight hours after transfection, the cells were lysed and subjected to immunoprecipitation using an anti-HA monoclonal antibody. Bound proteins were detected by Western blot using anti-HA and anti-Bet antibodies, revealing that Bet was bound by hA3F and hA3G in vivo, but not by mA3 (Fig. 6, hA3G and hA3F bound [B] compared to mA3 bound). This result correlates with the biological activity of PFV Bet, which reduced the inhibition of PFV infectivity caused by hA3G and, to a lesser extent, hA3F, but not the inhibition caused by mA3 (Fig. 3). As PFV Bet is not packaged into PFV vector particles (Fig. 4, top panel, even numbered lanes between 2 and 12), it is likely that once the APOBEC3 proteins have been bound by Bet they are unable to enter vector particles.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 6. The PFV Bet protein binds hA3G and hA3F, but not mA3, in vivo. 293T cells were transfected with pBet-PFV and each of the indicated HA-tagged APOBEC3-expression plasmids or pcDNA3 as a control (NEG). After 48 h, the transfected cells were lysed and immunoprecipitated using anti-HA tagged beads. Both input (I) and bound (B) fractions were analyzed by Western blot with either an anti-HA antibody (upper panel) or an anti-Bet antiserum (lower panel).

Foamy virus Bet proteins can rescue the infectivity of HIV-1 virions produced in the presence of agmA3G. The data presented so far reveal that the PFV Bet protein is able to specifically interact with hA3G and hA3F (Fig. 6) and that this interaction reduces the incorporation of hA3G and hA3F into PFV virion particles (Fig. 4) and partially rescues the infectivity of PFV virions produced in the presence of hA3G and hA3F (Fig. 3). This effect is specific, as PFV Bet fails to bind mA3 (Fig. 6) and neither reduces mA3 incorporation into PFV virions (Fig. 4) nor rescues the infectivity of PFV virions produced in the presence of mA3 (Fig. 3).

While PFV Bet therefore appears to function as the foamy virus ortholog of HIV-1 Vif, we noted at least one important difference, i.e., PFV Bet expression failed to reduce the level of expression of hA3G or hA3F in PFV virion producer cells (Fig. 4). In contrast, HIV-1 Vif is able to strongly reduce hA3G and hA3F expression by targeting these proteins for proteasomal degradation in coexpressing cells (8, 17, 22, 25-27, 35, 38, 43). We considered two possible hypotheses to explain this difference. Because PFV was passed extensively in culture prior to cloning (1, 12), it seemed possible that PFV Bet had acquired mutations that render it unable to induce APOBEC3 protein degradation. Conversely, this difference between HIV-1 Vif and PFV Bet could be reflective of a real dichotomy in the mechanisms of action of these retroviral auxiliary proteins.

To address this issue, we first cloned the bet gene from a second, very different primate foamy virus, i.e., the African green monkey foamy virus SFV-3 (29). The SFV-3 Bet protein is predicted to be slightly shorter than PFV Bet (470 amino acids versus 483 amino acids) and is 36% identical and 48% similar at the protein sequence level. We then asked whether SFV-3 Bet and PFV Bet would be able to rescue the infectivity of Vif-deficient HIV-1 virion particles produced in the presence of agmA3G and, particularly, whether these proteins would reduce the incorporation of agmA3G into HIV-1 virion particles and the expression of agmA3G in virion producer cells. We and others have previously reported that agmA3G is a potent inhibitor of the infectivity of HIV-1 virions produced in its presence (5, 24, 32). Moreover, inhibition by agmA3G is refractory to reversal by HIV-1 Vif, although the Vif protein encoded by the African green monkey simian immunodeficiency virus (SIVagm) is able to fully rescue HIV-1 infectivity (5, 24, 32).

As shown in Fig. 7, we were able to fully reproduce this latter result. Specifically, coexpression of agmA3G effectively inhibited the infectivity of Vif-deficient HIV-1 virions, and this inhibition could be fully relieved by SIVagm Vif but not by HIV-1 Vif (Fig. 7A). As expected, agmA3G was effectively packaged into HIV-1 virion particles. This packaging was entirely blocked by SIVagm Vif but was not affected by HIV-1 Vif (Fig. 7B). Moreover, SIVagm Vif greatly reduced the expression of the cognate agmA3G protein in virion producer cells while HIV-1 Vif, as expected, had no effect.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 7. Both PFV and SFV-3 Bet inhibit the incorporation of agmA3G into HIV-1 virions. A) 293T cells were transfected with 2.5 µg of pNL-HXB-LUC{Delta}VIF, 800 ng of a vector expressing a Vif or Bet protein and 200 ng of a vector expressing agmA3G. The parental pcDNA3.1 plasmid was used as a control. At 48 h, the HIV-1 virion containing supernatant media were harvested and used to infect susceptible cells. About 28 h later, induced luciferase activities were quantified. The results obtained are given relative to the level of luciferase activity seen in cells infected by HIV-1 virions produced in the absence of agmA3G, which was set at 100. Average of four experiments with standard deviation indicated. B) 293T cells were transfected as described in panel A, except that the pNL4-3{Delta}ENV{Delta}VIF proviral clone was used. At 48 h posttransfection, the virions produced by the transfected cultures were collected by ultracentrifugation and the lysed virions and a lysate of the virion producer cells were subjected to Western analysis using antibodies specific for the HA-epitope tag present on the agmA3G protein (upper two panels) or using an anti-HIV-1 capsid antiserum (lower panel).

Analysis of the biological activity of PFV and SFV-3 Bet showed that both were able to rescue the infectivity of HIV-1 virions produced in the presence of agmA3G, although the rescue was less complete than seen with SIVagm Vif (Fig. 7A). More importantly, we observed that both PFV and SFV-3 Bet were able to substantially reduce the incorporation of agmA3G into HIV-1 virion particles (Fig. 7B). This reduction in virion incorporation was not, however accompanied by any detectable decrease in the level of agmA3G expression in the virion producer cells. We therefore conclude that primate foamy virus Bet proteins are able to reduce HIV-1 virion incorporation of specific APOBEC3 proteins but that this is not due to a drop in the cellular expression of these proteins in producer cells.


arrow
DISCUSSION
 
The APOBEC3 family of proteins has recently emerged as an important class of innate antiretroviral resistance factors (13). More specifically, hA3G and hA3F have been shown to potently inhibit the infectivity of Vif-deficient HIV-1 variants (3, 20, 34, 40, 46), and hA3G has also been shown to function as a potent inhibitor of wild-type murine leukemia virus (MLV) (3, 11, 19). In contrast, wild-type HIV-1 is resistant to both hA3G and hA3F, which are bound by the viral Vif protein and targeted for proteasomal degradation (8, 17, 22, 25-27, 35, 38, 43). However, wild-type HIV-1 is sensitive to inhibition by a number of nonhuman APOBEC3 proteins, including agmA3G and the mA3 protein (3, 5, 24, 25, 32, 40). Similarly, MLV is resistant to the cognate mA3 protein but sensitive to hA3G, due to its ability to specifically exclude mA3, but not hA3G, from progeny virion particles (3, 11, 19). Together, these data suggest that retroviruses have evolved mechanisms that allow them to neutralize the antiretroviral activity of the APOBEC3 proteins found in their normal host species but remain susceptible to APOBEC3 proteins expressed by other, even quite closely related, species (25, 36).

From this perspective, we were intrigued by reports suggesting that humans are nonpermissive for replication of simian foamy viruses even though these viruses establish productive infections of a wide range of primate species, including chimpanzees, and are in fact common in both captive and wild simians (16, 33, 41). Could APOBEC3 proteins play a role in restricting primate foamy virus replication in infected humans?

To address this hypothesis, we first asked whether a vector derived from the PFV foamy virus isolate, which appears to be originally of chimpanzee origin (1, 12, 21), was susceptible to inhibition by APOBEC3 proteins of human and nonhuman origin. As shown in Fig. 1, this indeed proved to be the case. Moreover, sequencing of PFV proviral DNA produced in the presence of hA3G or hA3F revealed extensive G to A hypermutation of the PFV genome (Fig. 2), as also previously documented with Vif-deficient HIV-1 (14, 23, 40, 45). However, the finding that cpzA3G also inhibited the infectivity of this PFV-based vector (Fig. 1), albeit somewhat less efficiently than hA3G, hA3F, or mA3, raised the question of how PFV could replicate in its normal host species. We therefore asked whether the PFV accessory protein Bet, an ~53-kDA cytoplasmic protein of uncertain function that is expressed at high levels in PFV infected cells (4, 9, 21), might counteract this inhibitory activity. As shown in Fig. 3 and 4, this indeed proved to be the case. Specifically, PFV Bet, like HIV-1 Vif, was able to partially rescue the infectivity of PFV virions produced in the presence of hA3G and hA3F, and essentially completely rescue the infectivity of PFV virions produced in the presence of cpzA3G. In contrast, PFV Bet did not alleviate inhibition caused by the heterologous mA3 protein (Fig. 3). The rescue of infectivity by the PFV Bet protein correlated with a significant drop in the virion incorporation of hA3G, hA3F, and cpzA3G, while mA3 packaging into PFV virion particles remained unaffected (Fig. 4). Similarly, we observed that the Bet proteins encoded by PFV and SFV-3 were both able to partially rescue the infectivity of Vif-deficient HIV-1 virions produced in the presence of agmA3G by markedly reducing the virion incorporation of agmA3G (Fig. 7). Together, these data argue that primate foamy virus Bet proteins, like HIV-1 Vif, function to relieve the inhibition of retroviral virion infectivity induced by primate APOBEC3G proteins and thus identify a second, distinct class of retroviral gene products that has evolved to counteract these host intrinsic antiretroviral defense factors.

Although Bet expression attenuated the level of inhibition of PFV virion infectivity induced by hA3F, hA3G, and cpzA3G, the degree of rescue differed in each case. Specifically, PFV Bet almost entirely relieved the inhibition caused by cpzA3G, achieved moderate reversal of the inhibition caused by hA3G, and was relatively ineffective at reversing the inhibition caused by hA3F (Fig. 3). Although the reason for these differences remain to be established, we note that cpzA3G caused only an ~4-fold inhibition in PFV infectivity even in the absence of PFV Bet while hA3F inhibited by 10- to 20-fold, with hA3G generally intermediate (Fig. 1). Moreover, hA3F appeared to induce a higher level of editing of the PFV genome than did hA3G (Fig. 2). While these data raise the possibility that PFV, and perhaps other primate foamy viruses, may be more susceptible to inhibition by the APOBEC3 proteins expressed in primary human cells when compared to those present in their normal primate host, this hypothesis clearly remains unproven at this point.

The hA3G protein is packaged into Vif-deficient HIV-1 virions and into wild-type MLV virions due to a specific interaction with the NC region of Gag, together with either Gag or hA3G-bound RNA (2, 7, 11, 31, 44). While we demonstrate that PFV Gag also specifically binds to hA3G (Fig. 5), the lack of homology between the HIV-1 NC protein and PFV Gag could suggest that the mechanism of hA3G binding and incorporation is different. On the other hand, we note that the NC region of HIV-1 Gag consists predominantly of two zinc fingers that are required for the binding and packaging of the viral genomic RNA (10). Although the exact PFV Gag-APOBEC binding site remains to be determined, such zinc finger motifs do not exist in PFV Gag. Instead, it contains three glycine-arginine-rich boxes, one of which has recently been shown to function as the major determinant of genomic RNA packaging (37). It is therefore possible that the APOBEC3 proteins have evolved to exploit a conserved feature of the process of genomic RNA binding and packaging shared by a wide range of otherwise highly divergent retroviruses (44).

In the case of HIV-1, Vif inhibits the action of the APOBEC3 proteins hA3F and hA3G by binding them specifically and targeting them for proteasomal degradation (8, 17, 22, 25-27, 35, 38, 40, 43), thereby preventing their incorporation into newly formed virions. Vif-induced degradation has recently been shown to be through interactions with a Cullin5/ElonginBC E3 ubiquitin ligase complex (27, 43). Vif contains a highly conserved SLQXLA sequence that is similar to a motif, termed a SOCS box, that is used for E3 ubiquitin ligase recruitment by several cellular proteins (18). In vivo, Vif associates with both hA3G and ubiquitin E3 ligase complexes, leading to polyubiquitination of hA3G and its subsequent degradation (26, 27, 43). Mutation of the SLQXLA motif blocks the interaction of Vif with the Cullin5/ElonginBC complex and, hence, both the Vif-mediated degradation of hA3G and the rescue of HIV-1 virion infectivity (26, 27, 43). However, this mutation does not prevent hA3G binding by Vif, thus indicating that degradation of hA3G, rather than its sequestration into an hA3G/Vif complex, is key to the Vif-mediated rescue of HIV-1 virion infectivity.

Despite a lack of homology with HIV-1 Vif, the abundantly produced foamy virus accessory protein Bet also binds to hA3F and hA3G (Fig. 6), inhibits their encapsidation into viral particles (Fig. 4 and 7B), and rescues the infectivity of retroviral virions produced in their presence (Fig. 3 and 7A). However, unlike HIV-1 Vif, Bet does not induce hA3G and hA3F degradation (Fig. 4 and Fig. 7B). This is consistent with the lack of homology between Bet and Vif and particularly the absence of an SLQXLA motif in Bet. Therefore, it appears that Bet may simply sequester APOBEC3 proteins away from sites of progeny virion formation and/or inhibit Gag binding by the APOBEC3 proteins. In this regard, it is important to note that we did not detect any incorporation of Bet into progeny PFV virions in either the presence or absence of APOBEC3 proteins (Fig. 4), thus suggesting that Bet:APOBEC3 protein complexes may be selectively excluded from virion particles. Together, these data argue that while foamy virus Bet functions as an ortholog of the HIV-1 Vif protein, it likely uses an entirely distinct mechanism to inhibit virion incorporation of cellular APOBEC3 proteins.


arrow
ACKNOWLEDGMENTS
 
We thank Axel Rethwilm (Institute for Virology and Immunobiology, University of Würzburg), Martin Löchelt (German Cancer Research Center), Matthias Schweizer (Paul Ehrlich Institute), and Emma Smith (Imperial College London) for reagents used in this work.

This work was supported by funds from The Wellcome Trust and the Jefferiss Trust to M.O.M. and by NIH grants AI57099 and AI65301 to B.R.C.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Duke University Medical Center, Box 3025, Durham, NC 27710. Phone: (919) 684-3369. Fax: (919) 681-8979. E-mail: culle002{at}mc.duke.edu. Back

{dagger} These authors contributed equally to the manuscript. Back


arrow
REFERENCES
 
    1
  1. Achong, B. G., P. W. A. Mansell, M. A. Epstein, and P. Clifford. 1971. An unusual virus in cultures from a human nasopharyngeal carcinoma. J. Natl. Cancer Inst. 46:299-307.
  2. 2
  3. Alce, T. M., and W. Popik. 2004. APOBEC3G is incorporated into virus-like particles by a direct interaction with HIV-1 Gag nucleocapsid protein. J. Biol. Chem. 279:34083-34086.[Abstract/Free Full Text]
  4. 3
  5. Bishop, K. N., R. K. Holmes, A. M. Sheehy, N. O. Davidson, S.-J. Cho, and M. H. Malim. 2004. Cytidine deamination of retroviral DNA by diverse APOBEC proteins. Curr. Biol. 14:1392-1396.[CrossRef][Medline]
  6. 4
  7. Bock, M., M. Heinkelein, D. Lindemann, and A. Rethwilm. 1998. Cells expressing the human foamy virus (HFV) accessory Bet protein are resistant to productive HFV superinfection. Virology 250:194-204.[CrossRef][Medline]
  8. 5
  9. Bogerd, H. P., B. P. Doehle, H. L. Wiegand, and B. R. Cullen. 2004. A single amino acid difference in the host APOBEC3G protein controls the primate species specificity of -HIV type 1 virion infectivity factor. Proc. Natl. Acad. Sci. USA 101:3770-3774.[Abstract/Free Full Text]
  10. 6
  11. Brownawell, A. M., and I. G. Macara. 2002. Exportin-5, a novel karyopherin, mediates nuclear export of double-stranded RNA binding proteins. J. Cell Biol. 156:53-64.[Abstract/Free Full Text]
  12. 7
  13. Cen, S., F. Guo, M. Niu, J. Saadatmand, J. Deflassieux, and L. Kleiman. 2004. The interaction between HIV-1 Gag and APOBEC3G. J. Biol. Chem. 32:33177-33184.
  14. 8
  15. Conticello, S. G., R. S. Harris, and M. S. Neuberger. 2003. The Vif protein of HIV triggers degradation of the human antiretroviral DNA deaminase APOBEC3G. Curr. Biol. 13:2009-2013.[CrossRef][Medline]
  16. 9
  17. Cullen, B. R. 1992. Mechanism of action of regulatory proteins encoded by complex retroviruses. Microbiol. Rev. 56:375-394.[Abstract/Free Full Text]
  18. 10
  19. Darlix, J. L., C. Gabus, M.-T. Nugeyre, F. Clavel, and F. Barre-Sinoussi. 1990. cis elements and trans-acting factors involved in the RNA dimerization of the human immunodeficiency virus HIV-1. J. Mol. Biol. 216:689-699.[CrossRef][Medline]
  20. 11
  21. Doehle, B. P., A. Schäfer, H. L. Wiegand, H. P. Bogerd, and B. R. Cullen. Differential sensitivity of murine leukemia virus to APOBEC3-mediated inhibition is governed by virion exclusion. J. Virol. 13:8201-8207.
  22. 12
  23. Flügel, R. M., A. Rethwilm, B. Maurer, and G. Darai. 1987. Nucleotide sequence analysis of the env gene and its flanking regions of the human spumaretrovirus reveals two novel genes. EMBO J. 6:2077-2084.[Medline]
  24. 13
  25. Goff, S. P. 2004. Retrovirus restriction factors. Mol. Cell. 16:849-859.[CrossRef][Medline]
  26. 14
  27. Harris, R. S., K. N. Bishop, A. M. Sheehy, H. M. Craig, S. K. Petersen-Mahrt, I. N. Watt, M. S. Neuberger, and M. H. Malim. 2003. DNA deamination mediates innate immunity to retroviral infection. Cell 113:803-809.[CrossRef][Medline]
  28. 15
  29. Heinkelein, M., M. Dressler, J. Gergely, M. Rammling, H. Imrich, J. Thurow, D. Lindemann, and A. Rethwilm. 2002. Improved primate foamy virus vectors and packaging constructs. J. Virol. 76:3774-3783.[Abstract/Free Full Text]
  30. 16
  31. Heneine, W., W. M. Switzer, P. Sandstrom, J. Brown, S. Vedapuri, C. A. Schable, A. S. Khan, N. W. Lerche, M. Schweizer, D. Neumann-Haefelin, D., L. E. Chapman, and T. M. Folks. 1998. Identification of a human population infected with simian foamy viruses. Nat. Med. 4:403-407.[CrossRef][Medline]
  32. 17
  33. Kao, S., M. A. Khan, E. Miyagi, R. Plishka, A. Buckler-White, and K. Strebel. 2003. The human immunodeficiency virus type 1 Vif protein reduces intracellular expression and inhibits packaging of APOBEC3G (CEM15), a cellular inhibitor of virus infectivity. J. Virol. 77:1398-11407.
  34. 18
  35. Kile, B. T., B. A. Schulman, W. S. Alexander, N. A. Nicola, H. M. Martin, and D. J. Hilton. 2002. The SOCS box: a tale of destruction and degradation. Trends Biochem. Sci. 27:235-241.[CrossRef][Medline]
  36. 19
  37. Kobayashi, M., A. Takaori-Kondo, K. Shindo, A. Abudu, K. Fukunaga, and T. Uchiyama. 2004. APOBEC3G targets specific virus species. J. Virol. 78:8238-8244.[Abstract/Free Full Text]
  38. 20
  39. Liddament, M. T., W. L. Brown, A. J. Schumacher, and R. S. Harris. 2004. APOBEC3F properties and hypermutation preferences indicate activity against HIV-1 in vivo. Curr. Biol. 14:1385-1391.[CrossRef][Medline]
  40. 21
  41. Linial, M. L. 1999. Foamy viruses are unconventional retroviruses. J. Virol. 73:1747-1755.[Free Full Text]
  42. 22
  43. Liu, B., X. Yu, K. Luo, Y. Yu, and X. F. Yu. 2004. Influence of primate lentiviral Vif and proteasome inhibitors on human immunodeficiency virus type 1 virion packaging of APOBEC3G. J. Virol. 78:2072-2081.[Abstract/Free Full Text]
  44. 23
  45. Mangeat, B., P. Turelli, G. Caron, M. Friedli, L. Perrin, and D. Trono. 2003. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature 424:99-103.[CrossRef][Medline]
  46. 24
  47. Mangeat, B., P. Turelli, S. Liao, and D. Trono. 2004. A single amino acid determinant governs the species-specific sensitivity of APOBEC3G to Vif action. J. Biol. Chem. 279:14481-14483.[Abstract/Free Full Text]
  48. 25
  49. Mariani, R., D. Chen, B. Schröfelbauer, F. Navarro, R. König, B. Bollman, C. Munk, H. Nymark-McMahon, and N. R. Landau. 2003. Species-specific exclusion of APOBEC3G from HIV-1 virions by Vif. Cell 114:21-31.[CrossRef][Medline]
  50. 26
  51. Marin, M., K. M. Rose, S. L. Kozak, and D. Kabat. 2003. HIV-1 Vif protein binds the editing enzyme APOBEC3G and induces its degradation. Nat. Med. 9:1398-1403.[CrossRef][Medline]
  52. 27
  53. Mehle, A., B. Strack, P. Ancuta, C. Zhang, M. McPike, and D. Gabuzda. 2004. Vif overcomes the innate antiviral activity of APOBEC3G by promoting its degradation in the ubiquitin-proteasome pathway. J. Biol. Chem. 279:7792-7798.[Abstract/Free Full Text]
  54. 28
  55. Pietschmann, T., M. Heinkelein, M. Heldmann, H. Zentgraf, A. Rethwilm, and D. Lindemann. 1999. Foamy virus capsids require the cognate envelope protein for particle export. J. Virol. 73:2613-2621.[Abstract/Free Full Text]
  56. 29
  57. Renne, R., E. Friedl, M. Schweizer, U. Fleps, R. Turek, and D. Neumann-Haefelin. 1992. Genomic organization and expression of simian foamy virus type 3 (SFV-3). Virology 186:597-608.[CrossRef][Medline]
  58. 30
  59. Rösler, C., J. Köck, M. H. Malim, H. E. Blum, and F. von Weizsäcker. 2004. Comment on "Inhibition of hepatitis B virus replication by APOBEC3G".Science 305:1403.
  60. 31
  61. Schäfer, A., H. P. Bogerd, and B. R. Cullen. 2004. Specific packaging of APOBEC3G into HIV-1 virions is mediated by the nucleocapsid domain of the gag polyprotein precursor. Virology 328:163-168.[CrossRef][Medline]
  62. 32
  63. Schröfelbauer, B., D. Chen, and N. R. Landau. 2004. A single amino acid of APOBEC3G controls its species-specific interaction with virion infectivity factor (Vif). Proc. Natl. Acad. Sci. USA 101:3927-3932.[Abstract/Free Full Text]
  64. 33
  65. Schweizer, M., V. Falcone, J. Gange, R. Turek, and D. Neumann-Haefelin. 1997. Simian foamy virus isolated from an accidentally infected human individual. J. Virol. 71:4821-4824.[Abstract]
  66. 34
  67. Sheehy, A. M., N. C. Gaddis, J. D. Choi, and M. H. Malim. 2002. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418:646-650.[CrossRef][Medline]
  68. 35
  69. Sheehy, A. M., N. C. Gaddis, and M. H. Malim. 2003. The antiretroviral enzyme APOBEC3G is degraded by the proteasome in response to HIV-1 Vif. Nat. Med. 9:1404-1407.[CrossRef][Medline]
  70. 36
  71. Simon, J. H. M., D. L. Miller, R. A. M. Fouchier, M. A. Soares, K. W. C. Peden, and M. H. Malim. 1998. The regulation of primate immunodeficiency virus infectivity by Vif is cell species restricted: a role for Vif in determining virus host range and cross-species transmission. EMBO J. 17:1259-1267.[CrossRef][Medline]
  72. 37
  73. Stenbak, C. R., and M. L. Linial. 2004. Role of the C terminus of foamy virus Gag in RNA packaging and Pol expression. J. Virol. 78:9423-9430.[Abstract/Free Full Text]
  74. 38
  75. Stopak, K., C. de Noronha, W. Yonemoto, and W. C. Greene. 2003. HIV-1 Vif blocks the antiviral activity of APOBEC3G by impairing both its translation and intracellular stability. Mol. Cell. 12:591-601.[CrossRef][Medline]
  76. 39
  77. Turelli, P., B. Mangeat, S. Jost, S. Vianin, and D. Trono. 2004. Inhibition of hepatitis B virus replication by APOBEC3G. Science 303:1829.[Free Full Text]
  78. 40
  79. Wiegand, H. L., B. P. Doehle, H. P. Bogerd, and B. R. Cullen. 2004. A second human antiretroviral factor, APOBEC3F, is suppressed by the HIV-1 and HIV-2 Vif proteins. EMBO J. 23:2451-2458.[CrossRef][Medline]
  80. 41
  81. Wolfe, N. D., W. M. Switzer, J. K. Carr, V. B. Bhullar, V. Shanmugam, U. Tamoufe, A. T. Prosser, J. N. Torimiro, A. Wright, E. Mpoudi-Ngole, F. E. McCutchan, D. L. Birx, T. M. Folks, D. S. Burke, and W. Heneine. 2004. Naturally acquired simian retrovirus infections in central African hunters. Lancet 363:932-937.[CrossRef][Medline]
  82. 42
  83. Yu, Q., R. König, S. Pillai, K. Chiles, M. Kearney, S. Palmer, D. Richman, J. M. Coffin, and N. R. Landau. 2004. Single-strand specificity of APOBEC3G accounts for minus-strand deamination of the HIV genome. Nat. Struct. Mol. Biol. 11:435-442.[CrossRef][Medline]
  84. 43
  85. Yu, X., Y. Yu, B. Liu, K. Luo, W. Kong, P. Mao, and X. F. Yu. 2003. Induction of APOBEC3G ubiquitination and degradation by an HIV-1 Vif-Cul5-SCF complex. Science 302:1056-1060.[Abstract/Free Full Text]
  86. 44
  87. Zennou, V., D. Perez-Caballero, H. Göttlinger, and P. D. Bieniasz. 2004. APOBEC3G incorporation into human immunodeficiency virus type 1 particles. J. Virol. 78:12058-12061.[Abstract/Free Full Text]
  88. 45
  89. Zhang, H., B. Yang, R. J. Pomerantz, C. Zhang, S. C. Arunachalam, and L. Gao. 2003. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature 424:94-98.[CrossRef][Medline]
  90. 46
  91. Zheng, Y. H., D. Irwin, T. Kurosu, K. Tokunaga, T. Sata, and B. M. Peterlin. 2004. Human APOBEC3F is another host factor factor that blocks human immunodeficiency virus type 1 replication. J. Virol. 78:6073-6076.[Abstract/Free Full Text]


Journal of Virology, July 2005, p. 8724-8731, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.8724-8731.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Lin, H., Zhang, Z., Zhang, H., Yan, P., Wang, Q., Bai, L. (2009). Primary Culture of Human Blood-Retinal Barrier Cells and Preliminary Study of APOBEC3 Expression: An In Vitro Study. IOVS 50: 4436-4443 [Abstract] [Full Text]  
  • Zielonka, J., Bravo, I. G., Marino, D., Conrad, E., Perkovic, M., Battenberg, M., Cichutek, K., Munk, C. (2009). Restriction of Equine Infectious Anemia Virus by Equine APOBEC3 Cytidine Deaminases. J. Virol. 83: 7547-7559 [Abstract] [Full Text]  
  • Henriet, S., Mercenne, G., Bernacchi, S., Paillart, J.-C., Marquet, R. (2009). Tumultuous Relationship between the Human Immunodeficiency Virus Type 1 Viral Infectivity Factor (Vif) and the Human APOBEC-3G and APOBEC-3F Restriction Factors. Microbiol. Mol. Biol. Rev. 73: 211-232 [Abstract] [Full Text]  
  • Chiu, Y.-L., Greene, W. C (2009). APOBEC3G: an intracellular centurion. Phil Trans R Soc B 364: 689-703 [Abstract] [Full Text]  
  • Perkovic, M., Schmidt, S., Marino, D., Russell, R. A., Stauch, B., Hofmann, H., Kopietz, F., Kloke, B.-P., Zielonka, J., Strover, H., Hermle, J., Lindemann, D., Pathak, V. K., Schneider, G., Lochelt, M., Cichutek, K., Munk, C. (2009). Species-specific Inhibition of APOBEC3C by the Prototype Foamy Virus Protein Bet. J. Biol. Chem. 284: 5819-5826 [Abstract] [Full Text]  
  • Russell, R. A., Smith, J., Barr, R., Bhattacharyya, D., Pathak, V. K. (2009). Distinct Domains within APOBEC3G and APOBEC3F Interact with Separate Regions of Human Immunodeficiency Virus Type 1 Vif. J. Virol. 83: 1992-2003 [Abstract] [Full Text]  
  • Bogerd, H. P., Tallmadge, R. L., Oaks, J. L., Carpenter, S., Cullen, B. R. (2008). Equine Infectious Anemia Virus Resists the Antiretroviral Activity of Equine APOBEC3 Proteins through a Packaging-Independent Mechanism. J. Virol. 82: 11889-11901 [Abstract] [Full Text]  
  • Watashi, K., Khan, M., Yedavalli, V. R. K., Yeung, M. L., Strebel, K., Jeang, K.-T. (2008). Human Immunodeficiency Virus Type 1 Replication and Regulation of APOBEC3G by Peptidyl Prolyl Isomerase Pin1. J. Virol. 82: 9928-9936 [Abstract] [Full Text]  
  • Kinoshita, S. M., Taguchi, S. (2008). NF-IL6 (C/EBP{beta}) induces HIV-1 replication by inhibiting cytidine deaminase APOBEC3G. Proc. Natl. Acad. Sci. USA 105: 15022-15027 [Abstract] [Full Text]  
  • Bogerd, H. P., Cullen, B. R. (2008). Single-stranded RNA facilitates nucleocapsid: APOBEC3G complex formation. RNA 14: 1228-1236 [Abstract] [Full Text]  
  • Yap, M. W., Lindemann, D., Stanke, N., Reh, J., Westphal, D., Hanenberg, H., Ohkura, S., Stoye, J. P. (2008). Restriction of Foamy Viruses by Primate Trim5{alpha}. J. Virol. 82: 5429-5439 [Abstract] [Full Text]  
  • Muckenfuss, H., Kaiser, J. K., Krebil, E., Battenberg, M., Schwer, C., Cichutek, K., Munk, C., Flory, E. (2007). Sp1 and Sp3 regulate basal transcription of the human APOBEC3G gene. Nucleic Acids Res 35: 3784-3796 [Abstract] [Full Text]  
  • Kinomoto, M., Kanno, T., Shimura, M., Ishizaka, Y., Kojima, A., Kurata, T., Sata, T., Tokunaga, K. (2007). All APOBEC3 family proteins differentially inhibit LINE-1 retrotransposition. Nucleic Acids Res 35: 2955-2964 [Abstract] [Full Text]  
  • Derse, D., Hill, S. A., Princler, G., Lloyd, P., Heidecker, G. (2007). Resistance of human T cell leukemia virus type 1 to APOBEC3G restriction is mediated by elements in nucleocapsid. Proc. Natl. Acad. Sci. USA 104: 2915-2920 [Abstract] [Full Text]  
  • Stopak, K. S., Chiu, Y.-L., Kropp, J., Grant, R. M., Greene, W. C. (2007). Distinct Patterns of Cytokine Regulation of APOBEC3G Expression and Activity in Primary Lymphocytes, Macrophages, and Dendritic Cells. J. Biol. Chem. 282: 3539-3546 [Abstract] [Full Text]  
  • Doehle, B. P., Bogerd, H. P., Wiegand, H. L., Jouvenet, N., Bieniasz, P. D., Hunter, E., Cullen, B. R. (2006). The Betaretrovirus Mason-Pfizer Monkey Virus Selectively Excludes Simian APOBEC3G from Virion Particles. J. Virol. 80: 12102-12108 [Abstract] [Full Text]  
  • Hakata, Y., Landau, N. R. (2006). Reversed Functional Organization of Mouse and Human APOBEC3 Cytidine Deaminase Domains. J. Biol. Chem. 281: 36624-36631 [Abstract] [Full Text]  
  • Jonsson, S. R., Hache, G., Stenglein, M. D., Fahrenkrug, S. C., Andresdottir, V., Harris, R. S. (2006). Evolutionarily conserved and non-conserved retrovirus restriction activities of artiodactyl APOBEC3F proteins. Nucleic Acids Res 34: 5683-5694 [Abstract] [Full Text]  
  • Muckenfuss, H., Hamdorf, M., Held, U., Perkovic, M., Lower, J., Cichutek, K., Flory, E., Schumann, G. G., Munk, C. (2006). APOBEC3 Proteins Inhibit Human LINE-1 Retrotransposition. J. Biol. Chem. 281: 22161-22172 [Abstract] [Full Text]  
  • Stenglein, M. D., Harris, R. S. (2006). APOBEC3B and APOBEC3F Inhibit L1 Retrotransposition by a DNA Deamination-independent Mechanism. J. Biol. Chem. 281: 16837-16841 [Abstract] [Full Text]  
  • Wurtzer, S., Goubard, A., Mammano, F., Saragosti, S., Lecossier, D., Hance, A. J., Clavel, F. (2006). Functional Central Polypurine Tract Provides Downstream Protection of the Human Immunodeficiency Virus Type 1 Genome from Editing by APOBEC3G and APOBEC3B.. J. Virol. 80: 3679-3683 [Abstract] [Full Text]  
  • OhAinle, M., Kerns, J. A., Malik, H. S., Emerman, M. (2006). Adaptive Evolution and Antiviral Activity of the Conserved Mammalian Cytidine Deaminase APOBEC3H.. J. Virol. 80: 3853-3862 [Abstract] [Full Text]  
  • Chiu, Y.-L., Greene, W. C. (2006). APOBEC3 Cytidine Deaminases: Distinct Antiviral Actions along the Retroviral Life Cycle. J. Biol. Chem. 281: 8309-8312 [Abstract] [Full Text]  
  • Cullen, B. R. (2006). Role and Mechanism of Action of the APOBEC3 Family of Antiretroviral Resistance Factors. J. Virol. 80: 1067-1076 [Full Text]  
  • Delebecque, F., Suspene, R., Calattini, S., Casartelli, N., Saib, A., Froment, A., Wain-Hobson, S., Gessain, A., Vartanian, J.-P., Schwartz, O. (2006). Restriction of Foamy Viruses by APOBEC Cytidine Deaminases. J. Virol. 80: 605-614 [Abstract] [Full Text]  
  • Bogerd, H. P., Wiegand, H. L., Doehle, B. P., Lueders, K. K., Cullen, B. R. (2006). APOBEC3A and APOBEC3B are potent inhibitors of LTR-retrotransposon function in human cells. Nucleic Acids Res 34: 89-95 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, R. A.
Right arrow Articles by Cullen, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, R. A.
Right arrow Articles by Cullen, B. R.