Previous Article | Next Article 
Journal of Virology, June 2005, p. 7050-7058, Vol. 79, No. 11
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.11.7050-7058.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Hepatitis C Virus Replicons Escape RNA Interference Induced by a Short Interfering RNA Directed against the NS5b Coding Region
Joyce A. Wilson1 and
Christopher D. Richardson1,2*
Ontario Cancer Institute/University Health Network, 620 University Ave. Suite 706, Toronto, Canada M5G 2C1,1
Department of Medical Biophysics, University of Toronto, 610 University Ave., Toronto, Canada M5G 2M92
Received 27 July 2004/
Accepted 28 January 2005

ABSTRACT
RNA interference represents an exciting new technology that
could have therapeutic applications for the treatment of viral
infections. Hepatitis C virus (HCV) is a major cause of chronic
liver disease and affects over 270 million individuals worldwide.
The HCV genome is a single-stranded RNA that functions as both
an mRNA and a replication template, making it an attractive
target for therapeutic approaches using short interfering RNA
(siRNA). We have shown previously that double-stranded siRNA
molecules designed to target the HCV genome block gene expression
and RNA synthesis from hepatitis C replicons propagated in human
liver cells. However, we now show that this block is not complete.
After several treatments with a highly effective siRNA, we have
shown growth of replicon RNAs that are resistant to subsequent
treatment with the same siRNA. However, these replicon RNAs
were not resistant to siRNA targeting another part of the genome.
Sequence analysis of the siRNA-resistant replicons showed the
generation of point mutations within the siRNA target sequence.
In addition, the use of a combination of two siRNAs together
severely limited escape mutant evolution. This suggests that
RNA interference activity could be used as a treatment to reduce
the devastating effects of HCV replication on the liver and
the use of multiple siRNAs could prevent the emergence of resistant
viruses.

INTRODUCTION
RNA interference (RNAi) is a biological process in which double-stranded
RNA within the cell induces specific degradation of mRNA with
homologous sequences. Protein components of the RNA interference
machinery first cleave the long double-stranded RNA into 19-
to 21-base pair short interfering RNA (siRNA) and then use the
short RNA molecules as guides to target homologous RNA species
(reviewed in references
7 and
30). The introduction or expression
of siRNA in mammalian cells to target disease-causing genes
or virus-specific sequences for degradation represents a potential
new therapeutic strategy. Previous reports have shown that RNAi
induction has promising antiviral activity against positive-
and negative-stranded RNA viruses and DNA viruses in model systems
(
12,
23). A major concern regarding the use of RNA interference
activity against virus infections, particularly RNA viruses,
is the development of resistance. Many RNA viruses encode polymerase
enzymes that lack proofreading abilities and as a result have
high rates of mutation. Thus, there is a high probability that
viruses with resistance to RNA interference induced by a particular
siRNA will evolve during virus replication through the incorporation
of nucleotide mutations within the target sequence of the siRNA.
Previous reports have described the selection of human immunodeficiency
virus and poliovirus escape mutants in response to prolonged
RNA interference activity (
2,
4).
We have analyzed the potential of hepatitis C virus (HCV) to escape siRNA treatments. HCV infections can lead to the development of liver cirrhosis and hepatocellular carcinoma. Currently, the only treatment available for HCV infections is combined interferon-ribavirin therapy, a regimen that fails to cure the infection in 30 to 50% of cases. This is particularly true for HCV genotypes 1 and 2. Clearly, other treatments are required. We and others have reported that RNA interference represents a promising treatment option for HCV infections (14, 21, 24, 29). Since HCV cannot currently be grown in culture, RNA interference activity against HCV was analyzed using the HCV subgenomic replicon, a self-replicating HCV RNA that propagates in cell culture but does not yield infectious virus particles (1, 18). RNA interference activity directed against multiple target sequences of the HCV genome has been found to effectively block the synthesis of replicon RNA (reviewed in reference 22).
We now report that HCV replicons are able to escape RNA interference activity through the accumulation of nucleotide point mutations within the siRNA target sequence. Importantly, multiple point mutations were generated within the siRNA target sequence following several sequential treatments with the same siRNA, suggesting that a single base change in the target sequence of this siRNA is not sufficient to confer resistance to siRNA antiviral activity. We also show that resistant replicons are susceptible to RNA interference induced by an siRNA targeting another region of the replicon. Thus, unlike the situation involving resistance to chemical antiviral agents, which necessitates the design and development of new drugs, further treatments with siRNA would simply require the use of a nucleotide directed against an alternative target sequence. In addition, we show that through the use of two siRNAs in combination, the evolution of resistant replicons was severely limited.

MATERIALS AND METHODS
Cell culture.
The cell line Huh-7 (
20) was kindly provided by Stanley M. Lemon
(The University of Texas Medical Branch at Galveston, Galveston,
TX) and was routinely grown in Dulbecco's minimal essential
medium (DMEM) supplemented with nonessential amino acids, 100
U/ml of penicillin, 100 µg/ml of streptomycin, and 10%
fetal calf serum (Wisent Inc., Montreal, Canada). HCV replicon
cell lines AB12-A2 (
29) and BB7 (
1) were grown in medium containing
800 µg/ml of G418 active ingredient (geneticin; Gibco/Invitrogen,
Carlsbad, CA).
Short interfering RNA sequences and in vitro transcription of replicon RNA.
HCV-specific siRNAs 6367 and 6188, the nonsilencing control siRNA 6188 mm, and the HCV replicon plasmid HCVrepAB12 have been described previously (29). The target nucleotide sequences of each siRNA and the approximate location of the target in the HCV replicon genome are shown numerically in Fig. 1. The siRNA 6367 and siRNA 6188 numerical designations refer to the initial nucleotide numbers and their locations in the BB7 replicon transcript. Replicon RNA was transcribed from ScaI-linearized plasmid in vitro using the T7-Megascript in vitro transcription kit (Ambion, Austin, TX) according to the instructions of the manufacturer. After RNA synthesis, the DNA template was removed by three repeated digestions with 0.2 U/µl of DNase I enzyme at 37°C for 30 min.
Coelectroporation of HCV replicon RNA and siRNA and selection with G418.
Cells were electroporated using the protocol described by Lohmann
et al. (
17). For serial coelectroporation of replicon RNA and
siRNA, 10 ng of HCVrepAB12neo RNA and 40 pmol of siRNA were
coelectroporated into naïve Huh-7 cells. To assay for colony
formation, coelectroporated cells were transferred to 8 ml DMEM
and seeded into one 10-cm-diameter tissue culture dish. Twenty-four
hours later and every 3 to 4 days during selection, the medium
was replaced with fresh DMEM supplemented with 800 µg
G418 until colonies were visible. G418-resistant colonies were
pooled and expanded, and total cellular RNA was purified from
the replicon cell pool using Trizol. Three subsequent serial
siRNA treatments were done by coelectroporation of 10 µg
of total replicon cellular RNA from surviving G418-resistant
colonies and 40 pmol of the indicated siRNA. For coelectroporation
experiments designed to screen for siRNA-resistant replicon
RNA, siRNA and total cellular RNA were coelectroporated into
Huh-7 cells plated onto one 10-cm dish and selected with G418
as described above. The G418-resistant colonies were fixed and
stained with 0.1% gentian violet prior to enumeration.
Treatment of stable replicon cells with siRNA.
To treat replicon cells with siRNA, either AB12-A2 or BB7 cells were prepared as described previously (29) and electroporated with the indicated concentrations of siRNA. Cells from each electroporation were seeded onto one 100-cm tissue culture dish and grown for 3 weeks in medium containing 800 µg G418. Cells that survived G418 selection were harvested, expanded, and re-treated with siRNA by electroporation. This was repeated three to five times for each replicon cell line.
RNA purification.
Total RNA was isolated from Huh-7 cells using Trizol reagent (Life Technologies, Invitrogen, Carlsbad, CA).
sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot analysis of HCV protein levels.
Replicon cell lines were electroporated with 50 nM of the indicated siRNA using the method described above. Following electroporation, each sample was added to 8 ml of DMEM and 1 ml of this suspension was plated onto a 35-mm tissue culture dish. The cells were harvested at 72 h postelectroporation and were lysed in sodium dodecyl sulfate sample buffer. Protein was subjected to electrophoresis on polyacrylamide gels (Novex Invitrogen, Carlsbad, CA) and transferred to a Hybond-C Extra supported nitrocellulose membrane (Amersham Pharmacia, Piscataway, NJ). The blots were probed with monoclonal anti-NS3, anti-NS5B, and anti-actin using standard methods. Proteins were visualized using enhanced chemiluminescence (Amersham Pharmacia, Piscataway, NJ).
Reverse transcription (RT)-PCR, cloning, and sequencing of DNA fragments.
To analyze the development of escape mutations within the 6367 siRNA target sequence, the corresponding region of the HCV replicon was reverse transcribed, PCR amplified, and sequenced. Total cellular RNA from siRNA-treated or untreated replicon cells was reverse transcribed using the First-Strand cDNA Synthesis Kit and a random hexamer primer according to the manufacturer's recommended protocol (Amersham Biosciences, Little Chalfont, England). The 6367 siRNA target region of the HCV replicon was amplified by PCR using oligonucleotides NS5b 6100s TGCACTGAGCAACTCTTTGC and NS5b 6977as CAAGGTCGTCTCCGCATACG and Taq polymerase (Invitrogen, Carlsbad, CA) and cloned into the plasmid pCR2.1-TOPO using the TOPO-TA cloning kit and the recommended protocol (Invitrogen, Carlsbad, CA). Plasmids were sequenced using the M13 reverse and T7 promoter primers. Six individual escape mutant 6367 target sequences were cloned into the replicon cDNA construct by first transferring an HpaI-to-Sfil fragment for each mutant, an XhoI-to-EcoRV replicon subclone, and then inserting the XholI-to-EcoRV fragments into the AB12 snfBB7 replicon cDNA constructs. All constructs were confirmed by sequencing.

RESULTS
Attempts to select escape mutants that were resistant to RNA interference through serial coelectroporation of siRNA and HCV replicon RNA from surviving colonies.
In our previous report, we showed that coelectroporation of
HCV AB12 replicon (Fig.
1) RNA and siRNA caused a very potent
RNA interference effect which was characterized by a 99% inhibition
of colony formation compared to samples coelectroporated with
a nonsilencing control siRNA (
29). We wondered whether the resulting
1% of the surviving cell colonies contained replicons that were
resistant to RNA interference in general or to the specific
siRNA being used. To investigate these possibilities, we pooled
and harvested the colonies that grew after each siRNA treatment
and expanded them into new replicon cell lines. We then harvested
total cellular RNA from these cell lines (which consisted of
cellular RNA and HCV replicon RNA) and coelectroporated it with
the same siRNA that was used during previous treatments. We
repeated this process four successive times with either of two
HCV-specific siRNAs, 6188 and 6367, and analyzed the numbers
of colonies that formed after each siRNA treatment relative
to coelectroporation with a nonsilencing control siRNA, 6188
mm. If the few colonies that grew after each successive siRNA
treatment contained RNA interference-resistant replicons, we
would expect the numbers of colonies that grew after each subsequent
siRNA treatment to increase dramatically. Interestingly, we
did not see any significant change in the colony growth after
any of the four treatments with siRNA 6188 or 6367 (Fig.
2A and B).
Thus, the colonies that grew after coelectroporation
of replicon RNA with the HCV-specific siRNAs do not contain
RNAi-resistant HCV replicon RNA. Instead, these colonies may
have been derived from cells that contained replicon RNA but
had insufficient amounts of siRNA to induce RNA interference.
Alternatively, the few colonies that grew may have been derived
from cells that are defective in RNA interference activity.
However, cell lines from colonies that grew following four rounds
of coelectroporation with replicon RNA and siRNA 6188 or 6367
were still susceptible to HCV-specific RNA interference activity.
These cells exhibited decreased NS5b protein levels following
electroporation with siRNAs 6188 and 6367 (Fig.
2C). Thus, it
appears that that over the course of four serial coelectroporation
treatments, the replicon is incapable of generating siRNA escape
mutants. This is probably due to an almost complete elimination
of replicon RNA by RNA interference before significant replication
can occur and produce mutants. These experiments were repeated
using total RNA derived from established BB7 replicon cells,
which may contain greater sequence diversity and thus a greater
chance of containing an escape mutant. However, no resistant
replicons were detected (data not shown).
Development of RNA interference escape mutants by successive electroporations of siRNA into established HCV replicon cells.
Repeated coelectroporation of siRNA with HCV replicon RNA in
Huh-7 cells did not select replicon escape mutants. However,
using a different method, repeated electroporation of siRNA
into cell lines that harbored replicating HCV replicons, we
successfully generated RNA interference escape mutants. We reported
previously that electroporation of replicon cells with siRNA
6367 caused an 87.1% reduction in the levels of HCV replicon
RNA and near-complete clearance of HCV replicon-specific proteins
NS3 and NS5b from the cells (
29). We speculated that some of
the remaining replicon RNA might have developed resistance to
the siRNA. To test this hypothesis, we challenged replicon cells
AB12-A2 and BB7 five times with siRNA 6367. We first electroporated
each replicon cell line with 100 pmol of siRNA 6367. Cells still
harboring replicon RNA were selected by growth in G418 for 3
or 4 weeks. In subsequent treatments, the cells were electroporated
with 20 pmol or 100 pmol of siRNA 6367 in AB12-A2 and BB7 cells,
respectively. Each electroporation was followed by selection
with G418. The development of siRNA-resistant replicons was
assessed by coelectroporation of total RNA purified from the
G418-resistant HCV replicon cell lines and siRNA 6367 into fresh
Huh-7 cells following each round of electroporation and selection.
Since we have established that coelectroporation of siRNA 6367
and replicon RNA is about 99% effective in blocking colony formation,
we could assess the development of resistant replicons by analyzing
the relative numbers of colonies that grew after coelectroporation
with siRNA 6367 compared to coelectroporation with a nonsilencing
control siRNA 6188 mm. Figure
3A shows an example of the HCV
replicon colony formation ability from total RNA isolated from
AB12-A2 replicon cells after each consecutive treatment and
analyzed by coelectroporation into Huh-7 cells with siRNA 6367
(top row) or nonsilencing control siRNA 6188 mm (bottom row).
The relative levels of resistant replicons increased during
all five passages and reached a maximum level of 68% after five
treatments with siRNA (Fig.
3A and B). We did not see evidence
for the selection of cell lines that were deficient in RNA interference
activity, since subsequent to five treatments with siRNA 6367,
cell lines electroporated with siRNA 6188 still showed a significant
decrease in the levels of HCV nonstructural proteins NS3 and
NS5b by Western blot analysis (Fig.
4A, AB12 6367 T5, siRNA
6188, and Fig.
4B, BB7 6367 T5, siRNA 6188). Thus, the observed
resistance to siRNA 6367 was a feature of the replicon RNA and
not a general feature of the cell lines. RT-PCR amplification
and sequencing of the target region of siRNA 6367 confirmed
the development and selection of HCV escape mutant replicons
(Fig.
5A). We cloned and sequenced five cDNAs from cells following
treatment 1 and between 10 and 13 cDNA clones from cells following
siRNA treatments 3 and 5, using both AB12-A2 and BB7 replicon
cells. Replicon RNAs with point mutations within the siRNA 6367
target sequence were first seen after a single siRNA treatment
in the case of AB12-A2 cells. A variety of point mutations subsequently
accumulated within the siRNA 6367 target sequence, some being
silent and some leading to amino acid changes (Fig.
5A). Few
mutations occurred in the 300 nucleotides flanking the target
sequence or in replicon negative controls that were selected
in the absence of siRNA. When enumerated, the prevalence of
mutations within the 6367 target sequence was at least 10-fold
greater than that seen in the flanking sequence in T1, T3, and
T5 replicon RNA samples (Fig.
5B). However, the number of mutations
in the flanking sequence did not change significantly between
the untreated and siRNA-treated RNA samples. After five treatments,
some cDNA clones contained up to three point mutations (Fig.
5A), suggesting that one and even two point mutations within
the 6367 siRNA target sequence do not completely block RNA interference
activity.
Six of the adaptive mutations were inserted into the AB12 and
BB7 replicon cDNA constructs in order to analyze their abilities
to confer siRNA resistance on the replicon. In vitro-transcribed
mutant replicon RNA was coelecroporated with nonsilencing siRNA
or with 6367 into Huh-7 cells, and after selection, colony growth
was enumerated. The results are shown in Fig.
6. The ability
to resist siRNA 6367 was expressed as the relative percent colony
formation following coelectroporation with 6367 versus the colony
growth following coelectroporation with the nonsilencing siRNA,
6188 mm. The results confirm a resistance phenotype for most
of the isolated replicon mutants. The presence of a single base
change in mutation 147 led to recovery of 4 to 14% of the colony
formation activity in the presence of coelectroporated siRNA
6367, and the presence of combinations of two and three mutations
led to higher levels of resistance, between 30 and 100% (Fig.
6A). The variable levels of resistance shown by the escape mutant
replicons suggest that the coelectroporation method used to
enumerate the levels of resistance within an RNA population
may underestimate the actual numbers of replicons carrying point
mutations. We also saw some alterations in the colony formation
abilities of some of the mutants. Colony growth was enumerated
from the two independent experiments and presented separately
(Fig.
6A) due to variability in HCV replicon colony growth in
different passages of Huh-7 cells (
16). A single mutation present
in mutant 19 caused a T-to-A amino acid change that appeared
to affect replication fitness. Replicons that contained this
mutation, those containing escape mutant sequences 19 and 148,
showed 90% fewer colonies than wild-type replicon RNA when coelectroporated
with the nonsilencing control siRNA. The presence of this mutation
on two separate escape mutant clones is also somewhat curious,
since it lies in a region outside of the siRNA target sequence
and provides no significant resistance to coelectroporation
with siRNA 6367. However, this nucleotide is located within
the sequence that would be annealed by the siRNA sense strand
on the negative strand of the replicon RNA (Fig.
6B). Selection
for this mutation suggests the possibility that the minus strand
may be susceptible to RNAi. It remains to be determined if this
mutation affords resistance to siRNA 6367 during RNA replication.
Mutation 407 also caused a severely reduced growth phenotype
(100-fold fewer colonies), but only in the context of the BB7
replicon. It conferred normal colony-forming abilities when
cloned into the AB12 replicon construct. The reason for this
difference is unknown. The AB12 replicon was derived from BB7
by the addition of 12 nucleotides of the HCV internal ribosome
entry sequence-core coding sequence upstream of the neomycin
resistance gene and the introduction of two additional adaptive
mutations within the NS3 coding region (Fig.
1). The poor growth
of a BB7 replicon with mutation 407 suggests that the proline-to-serine
mutation may not be tolerated well by BB7. Perhaps the conformational
change of NS5b caused by the loss of a proline, or putative
phosphorylation of the introduced serine residue, may alter
an interaction between NS5b and a host or viral binding partner
and somehow the additional presence of adaptive mutations in
AB12 NS3 makes the NS5b interaction less sensitive to the alteration.
Serial electroporation with two siRNAs together significantly reduces the propensity for HCV to escape silencing.
We observed a rapid evolution of siRNA escape mutant replicon
RNA following treatments with a single siRNA. We speculated
that the use of multiple siRNAs in combinations would limit
the chances of developing viral escape mutants. We have tested
this hypothesis by repeating the serial siRNA electroporation
experiments on HCV replicon cells using two siRNAs, 6367 and
6188, in combination or using either siRNA alone. When treatments
were done using two siRNAs together, we observed a dramatic
decrease in the emergence of resistant replicons (Fig.
7). We
electroporated AB12-A2 HCV replicon cells three times with either
100 nM siRNA 6367, 100 nM siRNA 6188, or a combination of 50
nM 6367 and 50 nM siRNA 6188. Each electroporation was followed
by 3 weeks of selection in media containing G418 to remove cells
in which the replicon RNA had been cleared. Total-RNA samples
were purified from the G418-resistant cell lines following each
siRNA electroporation and screened for the presence of replicons
resistant to either siRNA by enumerating the colony formation
ability following coelectroporation with siRNAs 6367 or 6188
relative to the total colony-forming ability when coelectroporated
with a nonsilencing control siRNA, 6188 mm. The results are
shown in Fig.
7. As expected, there was a clear increase in
the presence of 6367-resistant replicons following repeated
treatments with siRNA 6367 (Fig.
7A, treatment 6367). In addition,
we saw evidence for the emergence of 6188-resistant replicons
following serial treatment with siRNA 6188 alone (Fig.
7B, treatment
6188). However, when both siRNAs 6188 and 6367 were used together,
there was little or no evidence for the development of resistance
to siRNA 6367 or 6188. The relative colony formation levels
in screens of RNAs from cells treated with both siRNAs (Fig.
7A, treatment Both, and B, treatment Both) were similar to those
seen in negative control screens, in which the siRNA used to
determine resistance was not the one used in the serial treatments
(Fig.
7A, treatment 6188, and B, treatment 6367). In the coelectroporation
screens using siRNA 6188, the background levels of colony growth
are higher than those seen in coelectroporation screens using
6367 because 6188 is slightly less effective at blocking replicon
colony formation than 6367 (
29). For both siRNAs, treatment
with a combination of both siRNAs led to significantly less,
or no, detectible development of resistant replicons. Thus,
the use of multiple highly effective siRNAs in combination to
treat HCV-infected patients would increase the chances of success.

DISCUSSION
After only one treatment with an siRNA targeting the NS5b coding
region of the HCV genome, we were able to generate HCV replicon
escape mutants containing sequence point mutations within the
siRNA target sequence. This result is not unexpected, since
HCV possesses an error-prone RNA-dependent RNA polymerase. Importantly,
after five consecutive siRNA treatments, several of the HCV
replicon escape mutants continued to accumulate point mutations
within the siRNA target sequence. A similar situation was previously
reported with human immunodeficiency virus RNA interference
escape mutants (
4). These results suggested that a single point
mutation in the target sequence does not block RNA interference
activity completely and that there is further selective pressure
to accumulate more point mutations. In fact, a replicon containing
a single point mutation was only 4 or 13% resistant to the target
siRNA, while the addition of a second point mutation increased
the resistance to as high as 70 to 80%. The activity of siRNA
6367 may have been as a micro-RNA (miRNA) on replicons having
one or more nucleotide mismatches, since miRNAs are identical
in structure to siRNAs but have sequence mismatches with their
target mRNA and act to block mRNA translation rather than to
induce RNA degradation (
27). A survey of the escape sequences
after five consecutive siRNA treatments showed a high level
of diversity. This was somewhat surprising to us, since one
would expect that the most fit and resistant replicon would
eventually dominate the population. We speculate that the diverse
HCV sequence population may occur because the differences in
the levels of resistance between the escape mutant replicons
is not great enough for any of the mutants to become dominant
within the time frame of the experiments.
After repeated treatments with siRNA, we did not see evidence of any general resistance to RNA interference activity, since replicons that resisted one siRNA were fully susceptible to another siRNA directed against another target sequence. However, it is still possible that stably replicating HCV replicons may have an inherent resistance to RNA interference. Established replicon RNA did not succumb to RNA interference activity immediately and replicated in the presence of siRNA to subsequently develop escape mutations. On the other hand, HCV replicon RNA that was coelectroporated with siRNA failed to establish escape mutants immediately after transfection, likely due to the high susceptibility of the RNA to interference activity in the Huh-7 cells. This suggests that HCV replicon RNA may be more resistant to RNA interference during the actual process of RNA replication but is sensitive immediately following electroporation, prior to replication. This hypothesis is supported by previous experiments in which coelectroporation of siRNA, along with replicon RNA, inhibited the growth of replicon colonies by 97 to 99% (27). In contrast, established HCV replicon RNA was less susceptible to siRNA treatment, and electroporation of replicon cells with the same HCV-specific siRNA caused only a 90% reduction in replicon RNA levels (27). It is possible that the replicative form of replicon RNA may be resistant to RNA interference activity due to its localization in membranous compartments (9, 19). However, the presence of mutation 19 at a nucleotide which would only be targeted by siRNA on the HCV replicon minus strand suggests that the negative strand might be susceptible. Another possibility is that HCV encodes a gene that inhibits RNA interference activity. Previous reports have shown no difference in RNAi susceptibility between the genomic and subgenomic replicons (15, 21) and suggest that the structural proteins and NS2 do not influence RNAi susceptibility. Other viral genes, such as those encoding influenza virus NS1 (3, 5) and vaccinia virus E3L proteins (6), can inhibit RNA interference activity when expressed in plant or insect cell lines. Both NS1 and E3L were first characterized for their activities against innate cellular immunity induced by interferon, and both are viral virulence factors. It remains to be determined whether genes expressed by the subgenomic replicon, perhaps NS5a (10) or NS3 (8), which have previously been reported to inhibit host interferon-related activities, also affect RNA interference activity.
There is great interest in the use of RNA interference for antiviral therapy, and HCV represents an attractive target for treatment using siRNA. The observation that HCV replicon RNA is highly susceptible to RNA interference activity immediately after electroporation suggests that the HCV genomic RNA may also be highly susceptible following virion entry into the host cell. The HCV genome may be protected from RNA interference activity due to encapsidation by core protein, but after uncoating it is possible that the viral RNA is highly susceptible to RNA interference activity during primary translation. If this is the case, we suggest that RNA interference may be particularly useful as a prophylactic treatment. Tissues that are pretreated with siRNA, or stably expressing siRNA from an expression vector, may be resistant to HCV infection. A potential application of this strategy could be to protect a donor liver prior to transplantation into an HCV-infected patient.
An obvious challenge in the use of siRNA as a therapeutic agent is the development of suitable delivery methods. There have been recent advances in delivery of siRNA using peptide and polymeric vehicles (13, 25) and in vivo application through injection of a large volume of liquid siRNA solutions into the tail veins of mice. The latter treatment could induce RNA interference in the mouse liver and prevent Fas-mediated apoptosis (26). We are investigating the use of different peptide delivery systems for the induction of RNA interference in cell culture and in mice, which could potentially be useful in treating HCV infections.
The likelihood of HCV developing escape mutations illustrates the importance of careful siRNA target sequence selection during the development of treatment strategies. The target sequence for siRNA 6367 is within the NS5b coding region. Since the sequence was able to tolerate several different combinations of mutations, this suggests that the sequence of this region of the virus is conducive to moderate change and is required primarily to encode a functional NS5b RNA-dependent RNA polymerase. The ability of the virus to tolerate such mutations is partly due to the degeneracy of the genetic code. In addition, several escape mutations were predicted to cause amino acid changes within NS5b, some of which did not appear to affect the function of the polymerase. This highlights the importance of selecting target regions of HCV whose functions are critical for viral transcription and replication.
Several conserved regions within the HCV 5' untranslated region (5' UTR) have been found to be viable targets for RNA interference (22) and have potential in therapeutic RNA interference strategies. For example, the 5' UTR acts as an internal ribosome entry sequence, and its activity is determined by RNA structural characteristics (11, 28). As such, the sequence does not tolerate nucleotide changes and is highly conserved between different HCV genotypes. Therefore, siRNA target sequences based on the 5' UTR region offer promise for siRNA-based treatments (15). We and others have predicted that one strategy to prevent the development of resistance is through the use of multiple siRNA targets in combination (15). We have now shown conclusively that by using two highly active siRNA targets we can dramatically decrease the ability of the replicon to develop resistance to either siRNA. Since the design of different siRNA targets relies simply on the knowledge of nucleotide sequence information, the number and variability of siRNA target combinations that can be designed and tested are vast. Future treatment strategies will rely on the identification of several highly effective target sequences that can be used in combination.

ACKNOWLEDGMENTS
We thank Charles M. Rice for sending us the plasmid pHCVrep1bBB7.
Huh-7 cells were kindly provided by Stanley M. Lemon.
This work was supported by Canadian Institutes of Health Research Grant EOP-38155 and CANVAC (Canadian Network of Centres of Excellence).

FOOTNOTES
* Corresponding author. Mailing address: 620 University Ave., Suite 706, Toronto, Ontario, Canada M5G 2C1. Phone: (416) 946-2849. Fax: (416) 204-2278. E-mail:
chrisr{at}uhnres.utoronto.ca.


REFERENCES
1 - Blight, K. J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation of HCV RNA replication in cell culture. Science 290:1972-1974.[Abstract/Free Full Text]
2 - Boden, D., O. Pusch, F. Lee, L. Tucker, and B. Ramratnam. 2003. Human immunodeficiency virus type 1 escape from RNA interference. J. Virol. 77:11531-11535.[Abstract/Free Full Text]
3 - Bucher, E., H. Hemmes, P. de Haan, R. Goldbach, and M. Prins. 2004. The influenza A virus NS1 protein binds small interfering RNAs and suppresses RNA silencing in plants. J. Gen. Virol. 85:983-991.[Abstract/Free Full Text]
4 - Das, A. T., T. R. Brummelkamp, E. M. Westerhout, M. Vink, M. Madiredjo, R. Bernards, and B. Berkhout. 2004. Human immunodeficiency virus type 1 escapes from RNA interference-mediated inhibition. J. Virol. 78:2601-2605.[Abstract/Free Full Text]
5 - Delgadillo, M. O., P. Saenz, B. Salvador, J. A. Garcia, and C. Simon-Mateo. 2004. Human influenza virus NS1 protein enhances viral pathogenicity and acts as an RNA silencing suppressor in plants. J. Gen. Virol. 85:993-999.[Abstract/Free Full Text]
6 - Ding, S. W., H. Li, R. Lu, F. Li, and W. X. Li. 2004. RNA silencing: a conserved antiviral immunity of plants and animals. Virus Res. 102:109-115.[CrossRef][Medline]
7 - Dykxhoorn, D. M., C. D. Novina, and P. A. Sharp. 2003. Killing the messenger: short RNAs that silence gene expression. Nat. Rev. Mol. Cell. Biol. 4:457-467.[CrossRef][Medline]
8 - Foy, E., K. Li, C. Wang, R. Sumpter, Jr., M. Ikeda, S. M. Lemon, and M. Gale, Jr. 2003. Regulation of interferon regulatory factor-3 by the hepatitis C virus serine protease. Science 300:1145-1148.[Abstract/Free Full Text]
9 - Gosert, R., D. Egger, V. Lohmann, R. Bartenschlager, H. E. Blum, K. Bienz, and D. Moradpour. 2003. Identification of the hepatitis C virus RNA replication complex in Huh-7 cells harboring subgenomic replicons. J. Virol. 77:5487-5492.[Abstract/Free Full Text]
10 - He, Y., and M. G. Katze. 2002. To interfere and to anti-interfere: the interplay between hepatitis C virus and interferon. Viral Immunol. 15:95-119.[CrossRef][Medline]
11 - Honda, M., E. A. Brown, and S. M. Lemon. 1996. Stability of a stem-loop involving the initiator AUG controls the efficiency of internal initiation of translation on hepatitis C virus RNA. RNA 2:955-968.[Abstract]
12 - Joost Haasnoot, P. C., D. Cupac, and B. Berkhout. 2003. Inhibition of virus replication by RNA interference. J. Biomed. Sci. 10:607-616.[Medline]
13 - Kakizawa, Y., S. Furukawa, and K. Kataoka. 2004. Block copolymer-coated calcium phosphate nanoparticles sensing intracellular environment for oligodeoxynucleotide and siRNA delivery. J. Control Release 97:345-356.[CrossRef][Medline]
14 - Kapadia, S. B., A. Brideau-Andersen, and F. V. Chisari. 2003. Interference of hepatitis C virus RNA replication by short interfering RNAs. Proc. Natl. Acad. Sci. USA 100:2014-2018.[Abstract/Free Full Text]
15 - Kronke, J., R. Kittler, F. Buchholz, M. P. Windisch, T. Pietschmann, R. Bartenschlager, and M. Frese. 2004. Alternative approaches for efficient inhibition of hepatitis C virus RNA replication by small interfering RNAs. J. Virol. 78:3436-3446.[Abstract/Free Full Text]
16 - Lohmann, V., S. Hoffmann, U. Herian, F. Penin, and R. Bartenschlager. 2003. Viral and cellular determinants of hepatitis C virus RNA replication in cell culture. J. Virol. 77:3007-3019.[Abstract/Free Full Text]
17 - Lohmann, V., F. Korner, A. Dobierzewska, and R. Bartenschlager. 2001. Mutations in hepatitis C virus RNAs conferring cell culture adaptation. J. Virol. 75:1437-1449.[Abstract/Free Full Text]
18 - Lohmann, V., F. Korner, J. Koch, U. Herian, L. Theilmann, and R. Bartenschlager. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110-113.[Abstract/Free Full Text]
19 - Mottola, G., G. Cardinali, A. Ceccacci, C. Trozzi, L. Bartholomew, M. R. Torrisi, E. Pedrazzini, S. Bonatti, and G. Migliaccio. 2002. Hepatitis C virus nonstructural proteins are localized in a modified endoplasmic reticulum of cells expressing viral subgenomic replicons. Virology 293:31-43.[CrossRef][Medline]
20 - Nakabayashi, H., K. Taketa, K. Miyano, T. Yamane, and J. Sato. 1982. Growth of human hepatoma cells lines with differentiated functions in chemically defined medium. Cancer Res. 42:3858-3863.[Abstract/Free Full Text]
21 - Randall, G., A. Grakoui, and C. M. Rice. 2003. Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs. Proc. Natl. Acad. Sci. USA 100:235-240.[Abstract/Free Full Text]
22 - Randall, G., and C. M. Rice. 2004. Interfering with hepatitis C virus RNA replication. Virus Res. 102:19-25.[CrossRef][Medline]
23 - Saleh, M. C., R. P. Van Rij, and R. Andino. 2004. RNA silencing in viral infections: insights from poliovirus. Virus Res. 102:11-17.[CrossRef][Medline]
24 - Seo, M. Y., S. Abrignani, M. Houghton, and J. H. Han. 2003. Small interfering RNA-mediated inhibition of hepatitis C virus replication in the human hepatoma cell line Huh-7. J. Virol. 77:810-812.
25 - Simeoni, F., M. C. Morris, F. Heitz, and G. Divita. 2003. Insight into the mechanism of the peptide-based gene delivery system MPG: implications for delivery of siRNA into mammalian cells. Nucleic Acids Res. 31:2717-2724.[Abstract/Free Full Text]
26 - Song, E., S. K. Lee, J. Wang, N. Ince, N. Ouyang, J. Min, J. Chen, P. Shankar, and J. Lieberman. 2003. RNA interference targeting Fas protects mice from fulminant hepatitis. Nat. Med. 9:347-351.[CrossRef][Medline]
27 - Tijsterman, M., and R. H. Plasterk. 2004. Dicers at RISC; the mechanism of RNAi. Cell 117:1-3.[CrossRef][Medline]
28 - Wang, C., S. Y. Le, N. Ali, and A. Siddiqui. 1995. An RNA pseudoknot is an essential structural element of the internal ribosome entry site located within the hepatitis C virus 5' noncoding region. RNA 1:526-537.[Abstract]
29 - Wilson, J. A., S. Jayasena, A. Khvorova, S. Sabatinos, I. G. Rodrigue-Gervais, S. Arya, F. Sarangi, M. Harris-Brandts, S. Beaulieu, and C. D. Richardson. 2003. RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc. Natl. Acad. Sci. USA 100:2783-2788.[Abstract/Free Full Text]
30 - Wilson, J. A., and C. D. Richardson. 2003. Induction of RNA interference using short interfering RNA expression vectors in cell culture and animal systems. Curr. Opin. Mol. Ther. 5:389-396.[Medline]
Journal of Virology, June 2005, p. 7050-7058, Vol. 79, No. 11
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.11.7050-7058.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Umbach, J. L., Cullen, B. R.
(2009). The role of RNAi and microRNAs in animal virus replication and antiviral immunity. Genes Dev.
23: 1151-1164
[Abstract]
[Full Text]
-
Shin, D., Lee, H., Kim, S. I., Yoon, Y., Kim, M.
(2009). Optimization of linear double-stranded RNA for the production of multiple siRNAs targeting hepatitis C virus. RNA
15: 898-910
[Abstract]
[Full Text]
-
von Eije, K. J., Brake, O. t., Berkhout, B.
(2008). Human Immunodeficiency Virus Type 1 Escape Is Restricted When Conserved Genome Sequences Are Targeted by RNA Interference. J. Virol.
82: 2895-2903
[Abstract]
[Full Text]
-
Aalto, A. P., Sarin, L. P., van Dijk, A. A., Saarma, M., Poranen, M. M., Arumae, U., Bamford, D. H.
(2007). Large-scale production of dsRNA and siRNA pools for RNA interference utilizing bacteriophage {phi}6 RNA-dependent RNA polymerase. RNA
13: 422-429
[Abstract]
[Full Text]
-
Kanda, T., Steele, R., Ray, R., Ray, R. B.
(2007). Small Interfering RNA Targeted to Hepatitis C Virus 5' Nontranslated Region Exerts Potent Antiviral Effect. J. Virol.
81: 669-676
[Abstract]
[Full Text]
-
Nishitsuji, H., Kohara, M., Kannagi, M., Masuda, T.
(2006). Effective Suppression of Human Immunodeficiency Virus Type 1 through a Combination of Short- or Long-Hairpin RNAs Targeting Essential Sequences for Retroviral Integration.. J. Virol.
80: 7658-7666
[Abstract]
[Full Text]
-
Kusov, Y., Kanda, T., Palmenberg, A., Sgro, J.-Y., Gauss-Muller, V.
(2006). Silencing of Hepatitis A Virus Infection by Small Interfering RNAs.. J. Virol.
80: 5599-5610
[Abstract]
[Full Text]
-
Simon-Mateo, C., Garcia, J. A.
(2006). MicroRNA-Guided Processing Impairs Plum Pox Virus Replication, but the Virus Readily Evolves To Escape This Silencing Mechanism. J. Virol.
80: 2429-2436
[Abstract]
[Full Text]
-
Sabariegos, R., Gimenez-Barcons, M., Tapia, N., Clotet, B., Martinez, M. A.
(2006). Sequence Homology Required by Human Immunodeficiency Virus Type 1 To Escape from Short Interfering RNAs. J. Virol.
80: 571-577
[Abstract]
[Full Text]