Previous Article | Next Article 
Journal of Virology, February 2000, p. 1241-1251, Vol. 74, No. 3
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of Multiple Transcription Factors,
HLF, FTF, and E4BP4, Controlling Hepatitis B Virus Enhancer
II
Hisashi
Ishida,1
Keiji
Ueda,2
Kazuyoshi
Ohkawa,1
Yoshiyuki
Kanazawa,1
Atsushi
Hosui,1
Fumihiko
Nakanishi,1
Eiji
Mita,1
Akinori
Kasahara,3
Yutaka
Sasaki,4
Masatsugu
Hori,1 and
Norio
Hayashi4,*
Department of Internal Medicine and
Therapeutics,1 Department of
Microbiology,2 Department of General
Medicine,3 and Department of
Molecular Therapeutics,4 Osaka University
Graduate School of Medicine, Suita, Osaka 565-0871, Japan
Received 28 May 1999/Accepted 3 November 1999
 |
ABSTRACT |
Hepatitis B virus (HBV) enhancer II (EnII) is a hepatotropic
cis element which is responsible for the
hepatocyte-specific gene expression of HBV. Multiple transcription
factors have been demonstrated to interact with this region. In this
study, the region from HBV nucleotides (nt) 1640 to 1663 in EnII was
demonstrated to be essential for enhancer activity and to be another
target sequence of putative transcription factors. To elucidate the
factors which bind to this region, we used a yeast one-hybrid screening system and cloned three transcription factors, HLF, FTF, and E4BP4, from a human adult liver cDNA library. All of these factors had binding
affinity to the sequence from nt 1640 to 1663. Investigation of the
effects of these factors on transcriptional regulation revealed that
HLF and FTF had stimulatory activity on nt 1640 to 1663, whereas E4BP4
had a suppressing effect. FTF coordinately activated both 3.5-kb RNA
and 2.4/2.1-kb RNA transcription in a transient transfection assay with
an HBV expression vector. HLF, however, activated only 3.5-kb RNA
transcription, and in primer extension analysis, HLF strongly
stimulated the synthesis of pregenome RNA compared to precore RNA.
Thus, FTF stimulated the activity of the second enhancer, while HLF
stimulated the activity of the core upstream regulatory sequence, which
affects only the core promoter, and had a dominant effect on the
pregenome RNA synthesis.
 |
INTRODUCTION |
Hepatitis B virus (HBV) causes acute
and chronic hepatitis in humans, and chronic infection is closely
associated with the development of hepatocellular carcinoma
(3). HBV has a partially double-stranded 3.2-kb DNA genome
containing four overlapping open reading frames (ORFs) encoding surface
antigen (HBsAg), core/e antigen (HBc/eAg), polymerase, and X protein
(19, 47). Four promoters (CP, SPI, SPII, and XP) have been
identified as cis regulators for transcription of the 3.5-, 2.4-, 2.1-, and 0.8-kb mRNAs, respectively. The 3.5-kb mRNA encodes
viral polymerase and HBc/eAg and functions as the pregenome RNA for
reverse transcription of the HBV genome as well (8, 45, 54,
56). The 2.4- and 2.1-kb mRNAs are the templates for large and
middle/major surface antigens, respectively (7, 36, 41, 43),
and the 0.8-kb mRNA is specific for X protein (42, 49). So
far, two regions in the HBV genome have been shown to act as
transcriptional enhancers. Enhancer I (EnI), which is located upstream
of the X gene, displays a preference for hepatocytes (40,
48), while enhancer II (EnII), located just upstream of CP, shows
highly restricted hepatocyte-specific activity (53, 57, 60);
both enhancers stimulate transcription from the promoters (2, 22,
28, 44, 51, 57, 60). In transfection analysis with cloned HBV
DNA, the 3.5-kb mRNAs were detected in well-differentiated human
hepatoma cell lines but not in nonhepatic cells (9, 46, 50,
55). This suggests that hepatocyte-specific factors are necessary
for the transcription of pregenome RNA and that the hepatotropism of
HBV replication might be attributable to the EnII function.
EnII stimulates the transcription from SPI, SPII, and XP in a position-
and orientation-independent manner (60). On the other hand,
this element regulates the basal CP positively only in a position- and
orientation-dependent manner, functioning as a core upstream regulatory
sequence (CURS), which coincides with the sequence of EnII
(61-63). Yuh et al. have demonstrated that CURS consists of
two sequence motifs, a 23-bp box
and a 12-bp box
, that
individually regulate transcription activity (61). Hepatocyte-enriched transcription factors, such as hepatocyte nuclear
factor 1 (HNF1) (52), HNF3 (29, 31), HNF4
(20, 38), CCAAT/enhancer binding protein (C/EBP) (34,
35, 61), and FTF (fetoprotein transcription factor; hB1F)
(32), which are suggested to be responsible for the
hepatocyte specificity of EnII activity, and the ubiquitous factor Sp1
(64) have been shown to interact with the EnII sequence and
regulate its function (Fig. 1). Several
factors were found to regulate HBV EnII, but details of the regulatory
mechanism are still unclear, and there remains the possibility that
other factors exist.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequences of HBV between nt 1570 to 1771 including the EnII region. The underlined sequences represent Sp1,
HNF1, HNF3, HNF4, and FTF (hB1F) recognition sequences, as labeled. Box
(nt 1645 to 1669) and box (nt 1705 to 1716) in the CURS are
shown in italics. The open box indicates the sequence from nt 1640 to
1663 which was used in gel retardation analysis. This region includes
the extended C/EBP consensus sequence (T[T/G]NNG[C/T]AA[T/G]).
|
|
In this study, transient transfection of HepG2 cells with EnII-minimal
TATA-luciferase vector constructs demonstrated that deletion of 20 bp
starting with nucleotide (nt) 1640 resulted in a great decrease in the
EnII activity. Gel retardation analyses using HepG2 nuclear extract and
32P-labeled double-stranded oligodeoxynucleotides
containing HBV nt 1640 to 1663 suggested that multiple factors bound to
this region. Next, we used a yeast one-hybrid system to clone
transcription factors which interact with HBV nt 1640 to 1663. From a
cDNA library of human adult normal liver, we isolated three cDNAs
coding HLF (hepatic leukemia factor), FTF, and E4BP4. HLF and E4BP4 are
bZIP transcription factors (12, 23, 25), and FTF is
characterized as an orphan nuclear receptor (18, 32).
Binding motifs for these factors could be found between nt 1640 to
1663. We investigated the interaction of these factors with HBV nt 1640 to 1663 in vitro and their regulatory effect on EnII in vivo. Although
all of the factors could bind to nt 1640 to 1663, E4BP4 showed no
activating effect and even repressed expression, while HLF and FTF
activated reporter gene expression. We further investigated their
effects on the transcription of HBV. FTF stimulated the expression of 3.5- and 2.4/2.1-kb RNAs, as determined by Northern blot analysis and
HBe/sAg production in the media of cultured cells, but HLF upregulated
only the 3.5-kb RNA and HBeAg. In primer extension analysis, HLF
strongly activated the transcription of pregenome RNA compared to
precore (pre-C) RNA. Thus, we demonstrated that HLF has
transcription activity on CURS rather than on EnII and dominantly regulates pregenome RNA transcription, which leads to
replication of HBV, and that FTF acts as a trans factor
regulating the activity of EnII.
 |
MATERIALS AND METHODS |
Plasmids.
The HBV sequence used in this study was of the
adw2 subtype (GenBank accession no. X02763). Numbering of
the HBV sequence started at the unique EcoRI site. pTATALUC
was constructed by removing the chloramphenicol acetyltransferase gene
from plasmid pE1bTATACAT (Clontech), followed by insertion of the
firefly luciferase reporter gene downstream of the minimal promoter.
The luciferase gene was derived from the
HindIII-KpnI fragment of pRSV-L
(15). Various lengths of fragments of HBV DNA EnII were
synthesized or generated by PCR and inserted upstream of the minimal
promoter of pTATALUC (Fig. 2 and 4). All
of the EnII sequences were inserted in the antisense orientation to
evaluate their enhancer activity.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Deletion analysis of HBV EnII. The deletion mutants are
shown at the left. Open boxes represent the EnII sequences, and the
numerals indicate nucleotides of the HBV genome. The fragment
containing the EnII region was cloned into pTATALUC just upstream of
the E1b minimal promoter in the antisense orientation. Plasmid DNA was
transfected into HepG2 cells, and luciferase activity was determined
for the lysate of each sample. Fold stimulation of luciferase activity
(mean ± standard deviation) is shown on the right.
|
|
Two oligonucleotides,
5'-GGGCTGCCCAAGGTCTTACATAAGAGGCTGCCCAAGGTCTTACATAAGAGGCTGCCCAAGGTCTTACATAAGAGGCTGCCCAAGGTCTTACATAAGAGGCTGCCCAAGGTCTTACATAAGAGGCCC-3'
and
5'-GGGCCTCTTATGTAAGACCTTGGGCAGCCTCTTATGTAAGACCTTGGGCAGCCTCTTATGTAAGACCTTGGGCAGCCTCTTAT
GTAAGACCTTGGGCAGCCTCTTATGTAAGACCTTGGGCAGCCC-3', containing
five
tandem 24-bp repeats of HBV nt 1640 to 1663 and some extra
nucleotides
for cloning to the
SmaI site, were synthesized,
annealed, and
then inserted into the
SmaI site of pTATALUC
in both sense and
antisense orientations to construct pTATALUC-E5 and
pTATALUC-E5AS.
The m4 sequence, CTGCCCgAGtTCTcACATAgGAGG,
was designed to contain
four nucleotide mutations (lowercase) in
the sequence from nt
1640 to 1663, and plasmids pTATALUC-m4 and
pTATALUC-m4AS, containing
five tandem repeats of the m4 sequence in the
sense and antisense
orientations, respectively, were constructed in the
same way as
pTATALUC-E5 and pTATALUCE5AS (Fig.
3). All fragments were confirmed
by
sequencing. Plasmids for yeast one-hybrid screening, pHIS-E5
and
pLac-E5, were constructed by inserting the double-stranded
oligonucleotide upstream of the E1b minimal promoter in pHISi-1
(Clontech) and the CYC1 minimal promoter in pLacZi (Clontech),
respectively.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3.
Transcriptional regulation of HBV nt 1640 to 1663 or
mutant sequence m4, which has four nucleotide mutations within nt 1640 to 1663. Five tandem repeats of the sequences were inserted upstream of
the E1b minimal promoter in the sense or antisense orientation. Fold
stimulation of luciferase activity (mean ± standard deviation) is
shown on the right.
|
|
A
HindIII-
XbaI fragment containing cDNA of
HLF from pSP64-HLF (a gift from Michael L. Cleary) was inserted into
the
HindIII-
XbaI
site of pBluescript II SK(+)
(Stratagene); then the
ClaI-
BamHI
fragment of
this plasmid was subcloned into the
ClaI-
BamHI
site
of pFLAG-CMV-2 (Eastman Kodak Company) to produce pCMVHLF. The
full-length cDNA of E4BP4 was amplified by PCR using 20 ng of
a human
liver cDNA library (Clontech), native
Pfu DNA polymerase
(Stratagene), and primers
5'-GGAAGCTTGATGCAGCTGAGAAAAATGCAG-3' and 5'-CCGAATTCTTACCCAGAGTCTGAAGCAGAG-3'.
The
PCR product was gel purified, digested with
HindIII and
XbaI,
and inserted into the
HindIII-
XbaI site of pFLAG-CMV-2 to produce
pCMVE4BP4. To construct the FTF expression vector, the two
oligonucleotides
5'-AGCTTATGCAAGTGTCTCAATTTAAAATGGTGAATTACTCCTATGATGAA-3' and
5'-GATCTTCATCATAGGAGTAATTCACCATTTTAAATTGAGACACTT
GCATA-3',
containing the sequence from nt 438 to the unique
BglII
site (nt 482) of FTF, were synthesized, annealed, and
inserted
into the
HindIII-
BglII site of
pFLAG-CMV-2. A DNA fragment including
the cDNA of FTF from the unique
BglII site to the TAA codon (nt
1865) was obtained by
digesting pGADFTF, which was isolated by
screening with the yeast
one-hybrid system, with
BglII. This DNA
fragment was then
inserted into the
BglII site of the vector containing
the 5'
sequence of the FTF gene mentioned above to produce pCMVFTF.
pCMVLUC
was constructed by inserting the luciferase gene from
pGL3-Basic
(Promega) downstream of the cytomegalovirus promoter
of pcDNA3
(Invitrogen).
For in vitro transcription-translation, plasmids pGEMHLF, pGEMFTF, and
pGEME4BP4 were constructed by inserting HLF, FTF, and
E4BP4 cDNAs,
respectively, downstream of the SP6 promoter of pGEM-3Zf(+)
(Promega).
The nucleotide sequences of HLF, FTF, and E4BP4 referred to in this
paper are from GenBank accession no. HUMHLF, HSU93553,
and HSE4BP4RN,
respectively.
cDNA cloning by the yeast one-hybrid system.
pLac-E5 and
pHIS-E5 were linearized by digestion with NcoI and
XhoI, respectively, and sequentially integrated into the
genome of Saccharomyces cerevisiae YM4271 (MATa
ura3-52 his3-200 ade2-101 lys2-801 leu2-3,112 trp1-903
tyr1-501) (Clontech), generating yeast reporter strain YM-E5.
Next, the yeast was transformed with the human adult liver MATCHMAKER
cDNA library (Clontech), which contains a human liver cDNA library
cloned into the EcoRI site of pGAD10 (Clontech), producing a
GAL4 activation domain-cDNA fusion protein in yeast cells. The
transformants were selected on uracil-, histidine-, and
leucine-deficient plates containing 20 mM 3-aminotriazole. Large
colonies (His+) were streaked onto another plate with the
same amino acid contents and assayed for
-galactosidase activity.
The colonies were transferred onto nitrocellulose filters (Hybond C
Extra; Amersham Pharmacia Biotech product no. RPN82E). The filters were
then submerged into liquid nitrogen for 1 min, placed on filter papers
presoaked with a buffer containing 0.8 mM
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside, and
incubated at 30°C. Colonies that turned blue (LacZ+) were
recovered, and plasmids were isolated from these clones. To confirm
that the candidate plasmids were true positives, they were transformed
into YM-E5 and retested for His+ phenotype and for
-galactosidase activity. The double-positive plasmids were
considered to be true positives, and their insert cDNAs were studied by sequencing.
Cell culture and DNA transfection.
The human hepatocellular
carcinoma cell lines HepG2 and HuH7 were cultured in Dulbecco's
modified Eagle's medium with 10% fetal bovine serum, glucose (1 mg/ml), penicillin G (100 U/ml), streptomycin (100 µg/ml), and
amphotericin B (0.25 µg/ml) at 37°C in a 5% CO2 atmosphere.
Approximately 3 × 10
5 HepG2 cells/well in six-well
dishes (Falcon 3046) were transfected with 0.5 µg of luciferase
expression
vector and 0.5 µg of

-galactosidase expression vector
pCMV

(Clontech),
which served as an internal control for
transfection efficiency,
using Lipofectin (Gibco-BRL). Cells were
harvested 3 days after
transfection. They were washed three times with
phosphate-buffered
saline, and the cell lysate was prepared as
instructed by the
manufacturer of PicaGene (Toyo Ink). Next, 50-µg
extracted protein
samples were assayed for luciferase and

-galactosidase activities.
Transfection efficiency was normalized to
the activity of the
internal control. Each set of experiments was
performed with two
different preparations and repeated three to four
times for each
preparation, and the mean fold stimulating activity
relative to
that of pTATALUC was
calculated.
For cotransfections of luciferase and transcription factor expression
vectors, approximately 3 × 10
5 HuH7 or HepG2
cells/well in six-well dishes were cotransfected
with 0.5 µg of
luciferase expression vector (pTATALUC, pTATALUC-E5,
pTATALUC-EII2, or pTATALUC-EII3), 0.5 µg of pFLAG-CMV-2, pCMVE4BP4,
pCMVHLF, or pCMVFTF, and 0.1 µg of pCMV

, using Lipofectin. Cells
were harvested, and cell lysates were prepared and assayed for
luciferase activity and for

-galactosidase activity as described
above. Each set of experiments was performed with two different
preparations and repeated five to six times for each preparation,
and
the mean fold activity of pTATALUC-E5, pTATALUC-EII2, and
pTATALUC-EII3
relative to that of pTATALUC was
calculated.
Preparation of nuclear extract and in vitro-translated
protein.
The nuclear extract was prepared as previously described
(16), with modification. About 108 cells were
harvested and washed three times with phosphate-buffered saline. After
centrifugation at 1,500 rpm (1.3 × 102 × g) for 5 min, the cell pellet was suspended in 5 volumes of buffer
A (10 mM HEPES-KOH [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride) and
incubated on ice for 5 min. After centrifugation at 1,500 rpm for 5 min, the pellet was resuspended in 3 volumes of buffer A; Nonidet P-40
was added to 0.05%, and then homogenization was effected with 20 strokes in a Dounce homogenizer. After pelleting of the nuclei by
centrifugation at 1,500 rpm for 5 min, the pellet was resuspended in 1 ml of buffer C (5 mM HEPES-KOH [pH 7.9], 26% glycerol, 1.5 mM
MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride), and NaCl was added to a final concentration of 300 mM. The
mixture was kept on ice for 30 min. After centrifugation at 15,000 rpm
(1.3 × 104 × g) for 20 min at 4°C,
the supernatant was collected and the nuclear extract was stored in
small aliquots at
80°C.
In vitro transcription-translation was performed with a coupled wheat
germ extract system (T
NT system; Promega) as instructed
by
the manufacturer. Briefly, cDNAs of E4BP4, HLF, and FTF inserted
downstream of the SP6 promoter of pGEM-3Zf(+) were incubated in
reaction mixtures with wheat germ extract and SP6 RNA polymerase
at
30°C for 120 min. The transcription-translation reactions were
stored
in small aliquots at

80°C.
Gel retardation analysis.
For gel retardation analysis, the
probe was prepared with a double-stranded oligonucleotide, which was
cloned into the HindIII site of pBluescript II SK(+) and
gel purified after digestion with HindIII (in the
following sequence, underlined nucleotides indicate nt 1640 and 1663, respectively, of the HBV sequence):
The oligonucleotide was dephosphorylated with calf intestine
alkaline phosphatase (Toyobo, Osaka, Japan) and end labeled
with
[

-
32P]ATP (Amersham Co., Ltd., Tokyo, Japan) and T4
polynucleotide
kinase (Toyobo). The double-stranded HNF1
oligonucleotide (
37)
was used as the nonspecific competitor or
32P
labeled for use as the positive control. The probe was incubated in 20 µl of
reaction mixture containing 20 µg of nuclear extract or 0.5 µl
of in vitro-translated product, 2 µg of poly(dI-dC) (Pharmacia,
Inc.), 20 mM HEPES (pH 7.9), 1 mM MgCl
2, 4% Ficoll, and
0.5 mM
DTT at room temperature for 30 min. The mixture was resolved on
4% polyacrylamide gel made in 0.25× Tris-borate-EDTA. Electrophoresis
was performed at 150 V for 2 h. Gels were dried and
autoradiographed.
For competition experiments, 10- and 50-fold molar
excesses of
unlabeled double-stranded oligonucleotides were
preincubated with
nuclear extracts for 5 min before addition of probe.
A double-stranded
oligonucleotide containing a mutant sequence of nt
1640 to 1663
(m4)
(mutated nucleotides are in lowercase letters; nt 1640 and 1663 are underlined) was synthesized for use as a probe or
competitor.
Northern blot and primer extension analyses.
Approximately
3 × 106 HuH7 cells in 10-cm-diameter dishes were
transfected with DNA (total of 10 µg per plate) consisting of 2.5 µg of pHBV1.5 (6) and 7.5 µg of pFLAG-CMV-2, pCMVHLF,
pCMVFTF, or pCMVE4BP4 with Lipofectin (Gibco-BRL). In some experiments, 1 µg of pCMVLUC was cotransfected as an internal control. The media
were collected to monitor HBe/sAg expression by radioimmunoassay (RIA),
and the cells were harvested 3 days after transfection. Total cellular
RNA from the transfected cells was isolated with ISOGEN (Nippon Gene),
and then 20 µg of total RNA was analyzed by Northern blotting with
the HBV adw2 probe. To compare the precise expression levels
of pregenome and pre-C RNAs, primer extension analyses were performed
with a primer extension kit (Promega) according to the manufacturer's
instructions. Briefly, mRNAs were selected from 100 µg of total RNAs
with oligo(dT). Antisense oligonucleotide 5'-GCCCCAAAGCCACCCAAGGCACAGCTTGGA-3' (nt 1832 to 1861 of HBV
adw2) was phosphorylated with [
-32P]ATP and
T4 polynucleotide kinase (Toyobo). Reaction mixtures containing mRNA,
the labeled probe, and avian myeloblastosis virus reverse transcriptase
were incubated at 42°C for 30 min and then resolved on a 7 M
urea-8% acrylamide gel, resulting in detection of 110- and 80-base
DNAs corresponding to pre-C and pregenome RNAs, respectively. To
determine the level of viral gene transcription, the band intensity of
the transcript was measured with an image analyzer (BAS2000; Fuji Film).
 |
RESULTS |
Deletion mutant analyses of the EnII element indicates the
importance of nt 1640 to 1663 for enhancer activity.
We generated
a series of luciferase gene expression vectors containing HBV fragments
spanning nt 1570 to 1771 and various deletion mutants, located just
upstream of the E1b minimal TATA-luciferase construct. Figure 2 shows a
serial 5' and 3' deletion analysis of EnII. The contribution of each
part of the HBV EnII sequence to enhancer activity was evaluated by
transient transfection analyses in the differentiated hepatoma cell
line HepG2. The full-length sequence (nt 1570 to 1771) increased the
level of gene expression 9.82-fold. When the region from nt 1570 to
1639 was deleted, luciferase expression increased, indicating negative
regulation of this region as reported by Lo and Ting (33).
Deletion of nt 1640 to 1659 led to a 3.5-fold reduction in luciferase
expression. Further deletions of nt 1660 to 1677 and nt 1678 to 1706 resulted in a mild reduction in luciferase expression. These data
suggested that the sequence from nt 1640 to 1659 had a significant
effect on gene expression. In contrast, none of the deletions from the 3' end resulted in marked expression of the luciferase gene, indicating that nt 1731 to 1771 had a pivotal role in transcriptional activation. Thus, the sequence from nt 1640 to 1663 was demonstrated to include one
of the regions important for enhancer activity.
To investigate the effect of the interaction between the sequence from
nt 1640 to 1663 and other regions, we inserted five
copies of nt 1640 to 1663 upstream of the minimal promoter (Fig.
3); moderate activities were found to
depend to some extent on
orientation. The m4 sequence, however, showed
no transcriptional
activity. These results indicated that the segment
from nt 1640
to 1663 was a weak independent regulatory element and that
this
region could be an independent transcription factor binding site.
Next, we constructed luciferase gene expression vectors containing
the
EnII sequence spanning nt 1640 to 1771 and various deletion
mutants
thereof (Fig.
4). Removal of nt 1664 to 1691 resulted
in reduction of
about twofold, and additional removal of nt 1692
to 1726 resulted in a
further twofold reduction. In contrast,
the sequence lacking nt 1731 to
1771 exhibited a severe decrease
in enhancer activity. Thus, HNF4 site
2 and the Sp1 sites seemed
to be essential for enhancer activity, and
cooperation between
HNF3 site 2 to HNF4 site 2 and the sequence from nt
1640 to 1663
seemed to be more important than that between HNF4 site 1 to HNF3
site 1 and the sequence from nt 1640 to 1663 (Fig.
2 and
4).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
Deletion analysis of HBV nt 1640 to 1771 to determine
the correlation between nt 1640 to 1663 and the region from nt 1664 to
1771. The sequences are shown at the left as open boxes. Fold
stimulation of luciferase activity (mean ± standard deviation) is
shown on the right.
|
|
Detection of specific factors interacting with nt 1640 to 1663 in
HepG2 nuclear extract by gel retardation analysis.
Since deletion
mutant analyses showed that the region from nt 1640 to 1663 was a
cis-acting element, some transcription factors should be
associated with this region. We performed gel retardation analyses
using double-stranded oligonucleotides corresponding to the sequence
from nt 1640 to 1663 as probes. When the HepG2 nuclear extract was used
in the reaction, a shifted band was detected (Fig.
5). It appeared to be specific since
there was competition for the signal by the unlabeled sequence from nt
1640 to 1663 but not by the nonspecific competitor, the HNF1 consensus
sequence, or the mutated sequence from nt 1640 to 1663. A
32P-labeled double-stranded oligonucleotide of the HNF1
consensus, used as a positive control and incubated with the same
nuclear extract, yielded a clear shifted band, confirming that the
HepG2 nuclear extract was appropriate for the assay. Compared to the HNF1 band, the shifted band from nt 1640 to 1663 appeared rather broad,
probably because of the presence of multiple bands, which suggested
that multiple factors which bound to nt 1640 to 1663 existed in the
HepG2 nuclear extract and might regulate EnII activity.

View larger version (105K):
[in this window]
[in a new window]
|
FIG. 5.
Gel retardation analysis of HBV nt 1640 to 1663. The
32P-labeled double-stranded oligonucleotide containing the
sequence from nt 1640 to 1663 (lane 1 to 7) or 32P-labeled
HNF1 consensus sequence (lanes 8 to 12) was incubated with HepG2
nuclear extract at room temperature for 30 min. The mixture was
resolved on a 4% polyacrylamide gel. Lane 1, probe only; lanes 2 to 7, probe and 10 µg of nuclear extract with no competitor (lane 2), with
10-fold molar excess of unlabeled specific oligonucleotide of nt 1640 to 1663 (lane 3), with 10- and 50-fold molar excess of unlabeled
nonspecific HNF1 oligonucleotide (lanes 4 and 5), and with 10- and
50-fold molar excess of unlabeled mutant sequence of nt 1640 to 1663, m4 (lanes 6 and 7), respectively; lane 8, probe only; lanes 8 to 12, probe and 10 µg of nuclear extract with no competitor (lane 9), with
10-fold molar excess of unlabeled HNF1 consensus sequence (lane 10),
and with 10- and 50-fold molar excess of unlabeled nonspecific
oligonucleotide of nt 1640 to 1663 (lanes 11 and 12). The specifically
shifted band of nt 1640 to 1663 is indicated by a bracket, and the
specifically shifted band of HNF1 is indicated by arrowheads.
|
|
Cloning of cDNAs encoding three transcription factors, HLF, FTF,
and E4BP4, which bind to HBV nt 1640 to 1663, by the yeast one-hybrid
system.
As indicated above, hepatocyte-specific transcription
factors should bind to HBV nt 1640 to 1663 and regulate EnII activity. To identify those factors, we used a yeast one-hybrid screening system.
Five tandem repeats of HBV nt 1640 to 1663 were used as bait for the
interaction with the fusion protein consisting of the putative
transcription factor and GAL4 activation domain produced in yeast
cells. Approximately 5 × 106 cDNA clones were
screened by transforming the yeast reporter strain YM-E5, and 24 double-positive clones were obtained. The plasmids were recovered from
the positive yeast clones and retransformed into YM-E5 to confirm these
positive tests. Next, three transcription factors, HLF (1 clone), FTF
(7 clones), and E4BP4 (16 clones), were identified by sequence analyses
as candidates that bind to HBV nt 1640 to 1663.
The cloned E4BP4 fragment contained nt 329 to 814 of the ORF in the
sense orientation. E4BP4 is a member of bZIP transcription
factors
originally cloned as a repressor protein for the E4 promoter
of
adenovirus (
12) and as an activator for the interleukin-3
(IL-3) promoter (
65). The protein transcribed from the
cloned
fragment contained the basic region as the DNA binding domain
and the leucine zipper domain as the dimerizing domain, suggesting
that
the cloned protein could bind to the DNA sequence motif.
The binding
site for E4BP4 was shown to have the consensus sequence
(G/A)T(G/T)A(C/T)GTAA(C/T) (
12), and the region from nt 1640
to 1663 contained a sequence homologous to the consensus in the
half
site from the 3' end (Fig.
6).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Nucleotide sequence of HBV nt 1640 to 1663. The
underlined sequences represent the regions homologous to FTF and
HLF/E4BP4 recognition sequences. Comparison of the HLF, FTF, and E4BP4
binding sequences in HBV EnII and their consensus binding sequences is
shown below (R = A or G; K = G or T; Y = C or T; W = A or T). The nucleotide sequence of HBV compared to the E4BP4
consensus is shown in the antisense orientation.
|
|
HLF is a hepatocyte-enriched transcription factor with characteristics
of the bZIP family. It was initially cloned as a fusion
protein,
E2A-HLF, produced by genomic translocation in acute lymphoblastic
leukemia cells (
23,
26). The cloned fragment of HLF
contained
a downstream sequence from nt 437, a region which included
the
basic region and the leucine zipper domain. Interestingly, HLF
and
E4BP4 have been demonstrated to share the same binding motif
(Fig.
6)
(
1,
27). Therefore, both HLF and E4BP4 may regulate
viral
gene expression through interaction with the same site of
HBV
EnII.
We obtained two kinds of FTF-encoding plasmids; one had the sequence
from nt 444 to 2176 in the antisense orientation, and
the other had nt
444 to 1237 in the sense orientation. Li et al.
reported the cloning of
hB1F, a factor binding to EnII with the
yeast one-hybrid system using
the EnII B1 region as bait (
32).
They isolated a plasmid
encoding the hB1F ORF in the antisense
orientation, suggesting that the
gene was transcribed by a cryptic
promoter around the ADH1 terminator
region of the vector. The
fragments of FTF cloned in the present study
had both the DNA
binding domain and the ligand binding domain. FTF is a
homolog
of the orphan nuclear receptor fushi tarazu factor I (FTZ-F1)
in
Drosophila melanogaster and is thought to have the same
binding
property as FTZ-F1. HBV nt 1640 to 1663 contained a sequence
that
fits the FTZ-F1 consensus ([T/C]CAAGG[T/A]CA) (Fig.
6)
(
18),
indicating that FTF could bind to that region. Thus,
all of the
three isolated cDNAs contained the DNA binding domains, and
their
binding sites lay within the sequence from nt 1640 to 1663. They
are likely to be involved in regulation of the transcriptional
activity
of
EnII.
Factors binding specifically to the sequence of HBV nt 1640 to
1663.
Since homologous sequences of the consensus motifs of the
three proteins identified with the yeast one-hybrid system could be
found within the region from nt 1640 to 1663, gel retardation analyses
were performed to confirm their binding to that sequence. The cDNAs
inserted downstream of the SP6 promoter were transcribed with SP6 RNA
polymerase and translated with wheat germ extract. As shown in Fig.
7A, all of the in vitro
transcription-translation products exhibited complex formation with the
probe for nt 1640 to 1663. Complex formation was abolished after
preincubation with an unlabeled double-stranded oligonucleotide of nt
1640 to 1663 but not with m4, the mutant sequence of nt 1640 to 1663, which had two nucleotide substitutions in the HLF/E4BP4 binding motif and two more substitutions in the FTF binding motif. Next, to confirm
specific binding of the factors to nt 1640 to 1663, gel retardation
analyses with a probe containing the m4 sequence were performed (Fig.
7B). None of the proteins showed complex formation with the mutant
probe, or the HepG2 nuclear extract contained no factors interacting
with the mutant sequence. These results indicated that all three
transcription factors bound specifically to the nucleotide sequence
from HBV nt 1640 to 1663 in EnII.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 7.
Gel retardation analyses detecting complex formation of
in vitro-translated protein or HepG2 nuclear extract and the probe
containing the sequence from nt 1640 to 1663 or m4, the mutant sequence
of nt 1640 to 1663. (A) Lane 1, probe only; lane 2, negative control
[NC; probe and 0.5 µl of in vitro translation reaction of
pGEM-3Zf(+)]; lanes 3 to 6, probe and 0.5 µl of in vitro translation
reaction of HLF without competitor (lane 3), with 10- and 50-fold molar
excess of unlabeled specific competitor of nt 1640 to 1663 (lanes 4 and
5), and with 50-fold molar excess of m4 (lane 6); lanes 7 to 10, probe
and 0.5 µl of in vitro translation reaction of FTF without competitor
(lane 7), with 10- and 50-fold molar excess of unlabeled specific
competitor of nt 1640 to 1663 (lanes 8 and 9), and with 50-fold molar
excess of m4 (lane 10); lanes 11 to 14, probe and 0.5 µl of in vitro
translation reaction of E4BP4 without competitor (lane 11), with 10- and 50-fold molar excess of unlabeled specific competitor of nt 1640 to
1663 (lanes 12 and 13), and with 50-fold molar excess of m4 (lane 14).
(B) Probes used in the assays were the sequence from nt 1640 to 1663 (lane 1, 3, 5, 7, and 9) and m4 (lane 2, 4, 6, 8, and 10). Lanes 1 and
2, probe only; lanes 3 and 4, probe and 0.5 µl of in vitro
translation reaction of HLF; lanes 5 and 6, probe and 0.5 µl of in
vitro translation reaction of FTF; lanes 7 and 8, probe and 0.5 µl of
in vitro translation reaction of E4BP4; lanes 9 and 10, probe and 10 µg of HepG2 nuclear extract.
|
|
Activation of HBV EnII by HLF and FTF and suppression by
E4BP4.
As all three transcription factors were shown to be able to
bind to EnII and to be expressed in human liver tissue (25, 30,
32), we measured luciferase activities in cells transfected with
pTATALUC, pTATALUC-E5, pTATALUC-EII2, and pTATALUC-EII3 in the presence
of overexpression of each factor. As shown in Fig. 8, luciferase gene expression by pTATALUC
increased after transfection with pCMVHLF and decreased after
transfection with pCMVE4BP4. This alteration of baseline luciferase
expression occurred probably because the original vector sequence of
pTATALUC contained several motifs homologous to the HLF/E4BP4 consensus
motif (data not shown). With respect to the luciferase activity of
pTATALUC-E5 compared to that of pTATALUC, the pCMVHLF
transfection in HuH7 cells showed that the presence of five iterations
of the sequence between nt 1640 to 1663 increased luciferase activity
about 25-fold. pCMVFTF demonstrated a more than eightfold increase in
luciferase activity. As luciferase activity was induced 1.76-fold in
the mock transfection experiment, HLF and FTF were shown to activate
the minimal promoter via interaction with nt 1640 to 1663. In contrast,
E4BP4 had a suppressive effect compared to the mock transfection
experiment.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 8.
Transcriptional regulation of nt 1640 to 1663 by HLF,
FTF, and E4BP4 in HuH7 cells (A) and HepG2 cells (B). pTATALUC,
pTATALUC-E5, which contains five iterations of nt 1640 to 1663 in
tandem, pTATALUC-EII2, which contains HBV nt 1640 to 1771, or
pTATALUC-EII3, which contains HBV nt 1660 to 1771, was cotransfected
with pFLAG-CMV-2, pCMVHLF, pCMVFTF, or pCMVE4BP4, and the cell lysate
was assayed for luciferase activity. The fold activity of each
transfectant relative to the cells transfected with pTATALUC and
pFLAG-CMV-2 was calculated.
|
|
We investigated the effects of these factors by cotransfection of a
vector containing the EnII configuration, pTATALUC-EII2
or
pTATALUC-EII3. Alteration of the luciferase activity of pTATALUC-EII3,
which did not include the HLF/E4BP4 binding motif in the EnII
region,
was observed again in the experiments using pCMVHLF and
pCMVE4BP4. As
pTATALUC-EII3 included another FTF binding site,
its luciferase
expression was upregulated by pCMVFTF cotransfection.
Comparing the
ratio of the luciferase activity of pTATALUC-EII2
to that of
pTATALUC-EII3, we found that both HLF and FTF stimulated
luciferase
expression in HuH7 cells about 6- and 4-fold, respectively,
while the
value for mock transfectants was 1.76-fold. E4BP4 showed
a slight
suppressive effect. Though the extents of induction in
the HLF and FTF
experiments were lower than in the experiments
comparing
pTATALUC and pTATALUC-E5, the results seemed reasonable
since
pTATALUC-EII2 contained only one iteration of nt 1640 to
1663. In
experiments using HepG2 cells, luciferase activities
were similar to
those for HuH7 cells, though somewhat lower. Taken
together, these
effects reflected the enhancer activity of the
EnII region, suggesting
that the three factors are involved in
the regulation of HBV gene
expression in
hepatocytes.
Effects of HLF, FTF, and E4BP4 on HBV transcription.
To assess
the effects of HLF, FTF, and E4BP4 on the transcription of HBV, we
performed transient cotransfection experiments with pHBV1.5, an HBV
expression vector, and pFLAG-CMV-2, pCMVHLF, pCMVFTF, or pCMVE4BP4.
With cotransfection of pCMVLUC as an internal control, no significant
difference was observed between the samples. As shown in Fig.
9A, FTF stimulated both 3.5- and
2.4/2.1-kb RNAs while E4BP4 had no significant effect on transcription.
Interestingly, HLF stimulated only 3.5-kb RNA transcription. The levels
of HBeAg and HBsAg, which were translated from 3.5- and 2.4/2.1-kb
RNAs, respectively, were the same as the levels of their own
transcripts including the HLF transfectant (Fig. 9B). As HLF stimulated
only transcription from CP, we evaluated the two classes of transcripts specific to the 3.5-kb RNA, the pregenome and pre-C RNAs, by the primer
extension method (Fig. 9C). The levels of pre-C RNA were upregulated in
the lanes representing pCMVHLF (about 1.5-fold) and pCMVFTF
(about 1.3-fold), consistent with the results for HBeAg. Among the
pregenome RNAs, however, the band for the HLF transfectant was
specifically amplified (about 5.9-fold). Thus, the transcriptional
activity of HLF may be specific to CP; it upregulated pregenome RNA
more strongly than pre-C RNA.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 9.
Regulation of HBV transcripts and of HBeAg and HBsAg by
HLF, FTF, E4BP4. HuH7 cells (3 × 106 per
10-cm-diameter dish) were transfected with 2.5 µg of pHBV1.5 and 7.5 µg of pFLAG-CMV-2, pCMVHLF, pCMVFTF, or pCMVE4BP4. (A) Northern blot
analysis of HBV transcripts. Total RNA (20 µg) was hybridized with an
HBV adw2 probe. Arrows indicate the 3.5- and 2.4/2.1-kb
transcripts. The band intensity of the HBV transcripts was measured
with an image analyzer. The band intensity of the reaction using
pFLAG-CMV-2 was considered 100%, and the band intensity relative to
this value was calculated. (B) Quantitation of the degree of expression
of HBeAg and HBsAg measured by RIA. The expression level of the
reaction using pFLAG-CMV-2 was considered 100%, and percent expression
relative to this value was calculated. (C) Synthesis of pre-C and
pregenome RNAs. mRNAs selected from 100 µg of total RNAs with
oligo(dT) were used for primer extension. The products corresponding to
pre-C and pregenome RNAs are indicated by arrows.
|
|
 |
DISCUSSION |
HBV EnII is a cis-acting element essential for the
expression of HBV genes and viral replication. It is located just
upstream of the pregenome RNA start site; the sequence is highly (more than 94%) conserved among HBV subtypes (Fig. 1) and thought to be
involved mainly in synthesis of this RNA. This activity displays differentiated liver cell specificity; it is strong in such
differentiated hepatoma cell lines as HepG2, HuH7, and HuH6 but not in
such nonliver cell lines as HeLa and CV-1 (53, 57, 60),
indicating the involvement of hepatocyte-specific factors. As previous
studies have demonstrated, hepatocyte-enriched transcription factors
HNF1, HNF3, HNF4, FTF (hB1F), and C/EBP, and other ubiquitous
transcription factors such as Sp1, have been thought to regulate gene
expression via interaction with EnII (20, 29, 31, 32, 34, 35, 38,
52, 64).
In this study, we demonstrated that the region from nt 1640 to 1663 of
HBV is an independent sequence which is sufficient for the enhancer
activity of EnII; deletion of this sequence resulted in a great
decrease in luciferase gene expression under the control of the minimal
promoter, and five tandem repeats of nt 1640 to 1663 increased
luciferase gene expression, which indicated that this sequence itself
possessed a modest cis-activating effect. The orientation
had some effect on this activity, implying that it does not conform to
the original definition of the enhancer. Gel retardation analyses
suggested that multiple putative transcription factors in the HepG2
nuclear extract bound to nt 1640 to 1663. When we performed gel
retardation analyses with the nonhepatic cell line HeLa nuclear
extract, the signal intensity of the band was much weaker than that of
the HepG2 nuclear extract, suggesting that the factors are hepatocyte
enriched (data not shown). Though the activity is modest, the sequence
from nt 1640 to 1663 is considered important because (i) none of the
transcription factor binding sites within EnII can be a definite
cis element, and EnII activity is exhibited by the
cooperative action of multiple transcription factors; (ii) considering
that lack of this region resulted in great decrease in EnII activity,
factors binding to this element may play a key role in transcription,
complementing or cooperating with other factors such as HNF4; and (iii)
EnII and CURS activities do not necessarily coincide, and it is
possible that EnII largely influences the function of CP.
In the study reported by Yuh and Ting, two putative transcription
factors in HepG2 cells were found to bind to box
, which partially
overlaps with nt 1640 to 1663 (61). Since this region appeared to have weak homology to the extended consensus for a C/EBP
binding site (T[T/G]NNG[C/T]AA[T/G]) (39), C/EBP may
be one of the hepatocyte-enriched transcription factors which bind to
this sequence. However, at a high concentration, C/EBP
, which is
expressed abundantly in hepatocytes, repressed the expression from CP
(34). Moreover, although the sequence of box
appeared to
have low homology to the extended consensus for a C/EBP binding site,
it showed transcription activity in HepG2 cells, in which C/EBP
is
expressed at a much lower level than in differentiated hepatocytes
(17). These data indicated that some transcription factors
other than C/EBP
might bind to box
. Alternatively, there may be
another factor binding to the region, not overlapping with box
,
between nt 1640 and 1663. To identify the trans factors regulating HBV gene expression, we used a yeast one-hybrid system to
clone these factors from a human adult liver cDNA library. In that
screening, five tandem repeats of nt 1640 to 1663 were used as bait,
and three cDNAs identical to transcription factors HLF, FTF, and E4BP4
were obtained; again C/EBP
was not picked up in our study.
HLF and E4BP4 belong to the family of bZIP transcription factors, which
are characterized by a region rich in basic amino acids followed by a
leucine zipper domain, through which they form a homo- or heterodimer
and interact with the target DNA motif. HLF was initially cloned as a
chimeric bZIP transcription factor, E2A-HLF, created by the
t(17;19)(q22;p13) chromosomal translocation in some cases of acute
leukemia involving pro-B lymphocytes (23-25). Expression of
the native form of HLF was shown to be restricted in liver and kidney
tissue but not in normal or transformed lymphoid cells. There is a
report that HLF may be involved in the expression of factor IX in the
liver (5), but the details of its function remain unclear.
As shown in Fig. 8, HLF displayed a strong trans-activating effect on EnII activity.
E4BP4 binds to the E4 promoter of adenovirus, the IL-1
promoter, the
gamma interferon promoter, and the A site of the IL-3 promoter
(11, 12, 65). Interestingly, E4BP4 has been shown to have
two antagonistic transcriptional properties, serving as a repressor of
the E4 promoter of adenovirus and an activator of the IL-3 promoter.
These different characteristics are thought to depend on the cellular
context. Recently, Lai and Ting demonstrated that E4BP4 repressed the
stimulating activity of box
in CURS and EnII (30). Our
results from the cotransfection experiment, which showed that
overexpressed E4BP4 suppressed transcription from a minimal promoter
followed by five tandem repeats of nt 1640 to 1663 or EnII sequence,
agreed with their data. Though luciferase activity decreased in the
presence of E4BP4 overexpression, the effect was relatively small when
the promoter region included only one copy of the E4BP4 binding motif.
Upon cotransfection with the HBV expression vector pHBV1.5, there was
no significant change in viral gene expression. As previously reported,
repression of E4BP4 is caused by interaction of the E4BP4 repression
domain with the TATA-binding protein-binding repressor protein Dr1
(13, 14), rendering E4BP4 an active transcriptional
repressor. On the other hand, Lai and Ting suggested that E4BP4
repressed transcription by binding site occlusion rather than by acting
as an active repressor (30). They mentioned the possibility
that other factors binding to overlapping or identical sites influence
the regulation of E4BP4. Considering that HLF and E4BP4 bind to the
same DNA motif, and HLF is substantially expressed in liver and HepG2
cells, it is likely that E4BP4 represses transcription by competing
with HLF for their shared binding motif.
FTF is categorized as a homolog of the orphan nuclear receptor FTZ-F1.
In previous studies, the rat FTZ-F1 homolog rFTF was found to activate
the
-fetoprotein gene and to be expressed in the liver and pancreas
(4, 18, 32), but there has been no report of its effect on
transcription in human hepatocytes. Recently, Li et al. reported that
they had cloned a transcription factor binding to the B1 region within
EnII (they named it hB1F, for human B1-binding factor) that was
identical to FTF (32). The B1 region is located downstream
of nt 1640 to 1663, which means that EnII contains two FTF binding
sites. It is not surprising that more than two binding motifs of some
transcription factor exist nearby, as both HNF3 and HNF4 have two
binding sites and Sp1 has three binding sites in EnII. The gel
retardation assay showed that FTF could bind to nt 1640 to 1663 (Fig.
7); in cotransfection analyses, it stimulated transcription from the
minimal promoter, resulting in an increase in luciferase activity (Fig.
8). In gel retardation analyses using HepG2 nuclear extract with mutant
double-stranded oligonucleotide m4 as a competitor (Fig. 5, lanes 6 and
7), no change was observed in the shifted band; when m4 was used as a probe, no complex formation was observed (Fig. 7B, lanes 9 and 10). As
demonstrated in Fig. 7B, the mutations introduced within nt 1640 to
1663 abolished binding affinity to HLF, FTF, and E4BP4, which are
expressed in HepG2 cells (23, 32), nor did it show complex
formation with HepG2 nuclear extract. In addition, m4 revealed no
transcriptional activity in HepG2 cells. These findings suggest that
the band may be produced by HLF, FTF, and E4BP4 in addition to C/EBP,
and the transcriptional activity of nt 1640 to 1663 is likely to be
exhibited by such factors.
Since these factors were demonstrated to have transcriptional
regulatory activity, we further investigated their effects on HBV RNA
transcription. After transfection with HBV expression vector pHBV1.5,
FTF coordinately increased the expression levels of both 3.5- and
2.4/2.1-kb RNAs, and the HBeAg and HBsAg levels in the media monitored
by RIA were consistent with the HBV transcripts. The regulation by HLF,
however, was different from the pattern for FTF: it strongly stimulated
transcription of the 3.5-kb RNA but had no significant effect on the
2.4/2.1-kb RNA. The EnII sequence is believed to have two roles when
acting as a cis element, as an enhancer of all promoters of
HBV and as a CURS to CP. The CURS region coincides with the sequence of
EnII but is applicable only to CP, functioning in a position- and
orientation-dependent manner (62). Taken together, the data
indicate that FTF upregulated the global enhancer activity of EnII and
HLF upregulated the CURS activity to specifically affect CP.
The 3.5-kb RNA is subdivided into two classes, pregenome RNA and pre-C
RNA. The 5' end of pregenome RNA is located within 30 bases downstream
from the beginning of the pre-C RNA. As previously demonstrated, the
syntheses of these two RNAs are regulated by two separate promoters,
and the expressions of these promoters are differentially regulated by
several factors (10, 58, 59). Our results of primer
extension analyses indicated that HLF upregulated both pre-C and, to an
even greater extent, pregenome RNA. Synthesis of the pregenome RNA is a
pivotal step in the replicative cycle of HBV, as it encodes proteins C
and P, which are essential for the formation of nucleocapsids, and
serves as the template for viral DNA synthesis. These findings imply
that HLF plays an important role in the viral replication in
hepatocytes, in which HLF is highly expressed. Differential regulation
of the RNAs transcribed from CP was demonstrated previously by Yu and
Mertz (59). HNF4, chicken ovalbumin upstream promoter
transcription factor 1 (COUP-TF1), human testicular receptor 2 (TR2),
and peroxisome proliferator-activated receptors (PPARs) as heterodimers
with retinoid X receptors (RXRs) can regulate transcription via
interaction with hormone response element DR1. HNF4 and TR2 repressed
synthesis of the pre-C RNA, PPAR
-RXR
activated synthesis of the
pregenome RNA, and COUP-TF1 coordinately repressed synthesis of both
the pre-C and pregenome RNAs. A recent study by Lai and Ting
(30) suggested that the C/EBP family and E4BP4 can bind to
box
and may be involved in the regulation of viral gene expression.
Therefore, HLF is another factor regulating RNA transcription from CP
differently via interaction with sites other than the HNF4 site. In
addition, HLF is one of the bZIP transcription factors regulating EnII
activity which may interact with each other (forming heterodimers,
competing for the binding site), leading to a subtle change in
transcriptional regulation depending on the cellular context
(21).
Finally, EnII activity is a result of cooperative action of various
transcription factors such as HNF1, HNF3, HNF4, Sp1, C/EBP, HLF, FTF,
and E4BP4. The factors which stimulate transcription of HBV gene must
be expressed in hepatocytes because the absence of even one of them
results in a great decrease in transcription. Since HLF and FTF were
demonstrated to be involved in HBV gene expression, though their
function in human hepatocytes is not yet established, and HBV
replication can be determined by the combined action of
hepatocyte-enriched factors leading to hepatotropism of HBV, we suggest
that controlling the functions of these factors may contribute to the
suppression of HBV replication and offer a therapeutic method for
treating HBV infection.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Therapeutics, Osaka University Graduate School of Medicine, 2-2, Yamadaoka, Suita, Osaka 565-0871, Japan. Phone: 81-6-6879-3441. Fax: 81-6-6879-3449. E-mail:
hayashi{at}moltx.med.osaka-u.ac.jp.
 |
REFERENCES |
| 1.
|
Altura, R. A.,
T. Inukai,
R. A. Ashmun,
G. P. Zambetti,
M. F. Roussel, and A. T. Look.
1998.
The chimeric E2A-HLF transcription factor abrogates p53-induced apoptosis in myeloid leukemia cells.
Blood
92:1397-1405[Abstract/Free Full Text].
|
| 2.
|
Antonucci, T. K., and W. J. Rutter.
1989.
Hepatitis B virus (HBV) promoters are regulated by the HBV enhancer in a tissue-specific manner.
J. Virol.
63:579-583[Abstract/Free Full Text].
|
| 3.
|
Beasley, R. P.,
L.-Y. Hwang,
C.-C. Lin, and C.-S. Chien.
1981.
Hepatocellular carcinoma and hepatitis B virus: a prospective study of 22,707 men in Taiwan.
Lancet
ii:1129-1133.
|
| 4.
|
Bernier, D.,
H. Thomassin,
D. Allard,
M. Guertin,
D. Hamel,
M. Blaquière,
M. Beauchemin,
H. LaRue,
M. Estable-Puig, and L. Bélanger.
1993.
Functional analysis of developmentally regulated chromatin-hypersensitive domains carrying the 1-fetoprotein gene promoter and the albumin/ 1-fetoprotein intergenic enhancer.
Mol. Cell. Biol.
13:1619-1633[Abstract/Free Full Text].
|
| 5.
|
Boccia, L. M.,
D. Lillicrap,
K. Newcombe, and C. R. Mueller.
1996.
Binding of the Ets factor GA-binding protein to an upstream site in the factor IX promoter is critical event in transactivation.
Mol. Cell. Biol.
16:1929-1935[Abstract].
|
| 6.
|
Bruss, V., and D. Ganem.
1991.
The role of envelope proteins in hepatitis B virus assembly.
Proc. Natl. Acad. Sci. USA
88:1059-1063[Abstract/Free Full Text].
|
| 7.
|
Cattaneo, R.,
H. Will,
N. Hernandez, and H. Schaller.
1983.
Signals regulating hepatitis B surface antigen transcription.
Nature
305:336-338[CrossRef][Medline].
|
| 8.
|
Cattaneo, R.,
H. Will, and H. Schaller.
1984.
Hepatitis B virus transcription in the infected liver.
EMBO J.
3:2191-2196[Medline].
|
| 9.
|
Chang, C.,
K.-S. Jeng,
C.-P. Hu,
S. J. Lo,
T.-S. Su,
L.-P. Ting,
C.-K. Chou,
S.-H. Han,
E. Pfaff,
J. Salfeld, and H. Schaller.
1987.
Production of hepatitis B virus in vitro by transient expression of cloned HBV DNA in a hepatoma cell line.
EMBO J.
6:675-680[Medline].
|
| 10.
|
Chen, I.-H.,
C.-J. Huang, and L.-P. Ting.
1995.
Overlapping initiator and TATA box functions in the basal core promoter of hepatitis B virus.
J. Virol.
69:3647-3657[Abstract].
|
| 11.
|
Chen, W.-J.,
K. S. Lewis,
G. Chandra,
J. P. Cogswell,
S. W. Stinnett,
S. H. Kadwell, and J. G. Gray.
1995.
Characterization of human E4BP4, a phosphorylated bZIP factor.
Biochim. Biophys. Acta
1264:388-396[Medline].
|
| 12.
|
Cowell, I. G.,
A. Skinner, and H. C. Hurst.
1992.
Transcriptional repression by a novel member of the bZIP family of transcription factors.
Mol. Cell. Biol.
12:3070-3077[Abstract/Free Full Text].
|
| 13.
|
Cowell, I. G., and H. C. Hurst.
1994.
Transcriptional repression by the human bZIP factor E4BP4: definition of a minimal repression domain.
Nucleic Acids Res.
22:59-65[Abstract/Free Full Text].
|
| 14.
|
Cowell, I. G., and H. C. Hurst.
1996.
Protein-protein interaction between the transcriptional repressor E4BP4 and the TBP-binding protein Dr1.
Nucleic Acids Res.
18:3607-3613.
|
| 15.
|
De Wet, J. R.,
K. V. Wood,
M. DeLuca,
D. R. Helinski, and S. Subramani.
1987.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol. Cell. Biol.
7:725-737[Abstract/Free Full Text].
|
| 16.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 17.
|
Friedman, A. D.,
W. H. Landschulz, and S. L. McKnight.
1989.
CCAAT/enhancer binding protein activates the promoter of the serum albumin gene in cultured hepatoma cells.
Genes Dev.
3:1314-1322[Abstract/Free Full Text].
|
| 18.
|
Galarneau, L.,
J.-F. Paré,
D. Allard,
D. Hamel,
L. Lévesque,
J. D. Tugwood,
S. Green, and L. Bélanger.
1996.
The 1-fetoprotein locus is activated by a nuclear receptor of the Drosophila FTZ-F1 family.
Mol. Cell. Biol.
16:3853-3865[Abstract].
|
| 19.
|
Ganem, D., and H. E. Varmus.
1987.
The molecular biology of the hepatitis B virus.
Annu. Rev. Biochem.
56:651-693[CrossRef][Medline].
|
| 20.
|
Guo, W.,
M. Chen,
T. S. B. Yen, and J.-H. Ou.
1993.
Hepatocyte-specific expression of the hepatitis B virus core promoter depends on both positive and negative regulation.
Mol. Cell. Biol.
13:443-448[Abstract/Free Full Text].
|
| 21.
|
Haas, N. B.,
C. A. Cantwell,
P. F. Johnson, and J. B. E. Burch.
1995.
DNA-binding specificity of the PAR basic leucine zipper protein VBP partially overlaps those of the C/EBP and CREB/ATF families and is influenced by domains that flank the core basic region.
Mol. Cell. Biol.
15:1923-1932[Abstract].
|
| 22.
|
Honigwachs, J.,
O. Faktor,
R. Dikstein,
Y. Shaul, and O. Laub.
1989.
Liver-specific expression of hepatitis B virus is determined by the combined action of the core gene promoter and the enhancer.
J. Virol.
63:919-924[Abstract/Free Full Text].
|
| 23.
|
Hunger, S. P.,
K. Ohyashiki,
K. Toyama, and M. L. Cleary.
1992.
Hlf, a novel hepatic bZIP protein, shows altered DNA-binding properties following fusion to E2A in t(17;19) acute lymphoblastic leukemia.
Genes Dev.
6:1608-1620[Abstract/Free Full Text].
|
| 24.
|
Hunger, S. P.,
R. Brown, and M. L. Cleary.
1994.
DNA-binding and transcriptional regulatory properties of hepatic leukemia factor (HLF) and the t(17;19) acute lymphoblastic leukemia chimera E2A-HLF.
Mol. Cell. Biol.
14:5986-5996[Abstract/Free Full Text].
|
| 25.
|
Inaba, T.,
W. M. Roberts,
L. H. Shapiro,
K. W. Jolly,
S. C. Raimondi,
S. D. Smith, and A. T. Look.
1992.
Fusion of the leucine zipper gene HLF to the E2A gene in human acute B-lineage leukemia.
Science
257:531-534[Abstract/Free Full Text].
|
| 26.
|
Inaba, T.,
L. H. Shapiro,
T. Funabiki,
A. E. Sinclair,
B. G. Jones,
R. A. Ashmun, and A. T. Look.
1994.
DNA-binding specificity and trans-activating potential of the leukemia-associated E2A-hepatic leukemia factor fusion protein.
Mol. Cell. Biol.
14:3403-3413[Abstract/Free Full Text].
|
| 27.
|
Ishikura, S.,
T. Inukai,
T. Inaba,
S. D. Nimer,
J. L. Cleveland, and A. T. Look.
1997.
Pivotal role for the NFIL3/E4BP4 transcription factor in interleukin 3-mediated survival of pro-B lymphocytes.
Proc. Natl. Acad. Sci. USA
94:2609-2614[Abstract/Free Full Text].
|
| 28.
|
Jammel, S., and A. Siddiqui.
1986.
The human hepatitis B virus enhancer requires trans-acting cellular factor(s) for activity.
Mol. Cell. Biol.
6:710-715[Abstract/Free Full Text].
|
| 29.
|
Johnson, J. L.,
A. K. Raney, and A. McLachlan.
1995.
Characterization of a functional hepatocyte nuclear factor 3 binding site in the hepatitis B virus nucleocapsid promoter.
Virology
208:147-158[CrossRef][Medline].
|
| 30.
|
Lai, C.-K., and L.-P. Ting.
1999.
Transcriptional repression of human hepatitis B virus genes by a bZIP family member, E4BP4.
J. Virol.
73:3197-3209[Abstract/Free Full Text].
|
| 31.
|
Li, M.,
Y. Xie,
X. Wu,
Y. Kong, and Y. Wang.
1995.
HNF3 binds and activates the second enhancer, ENII, of hepatitis B virus.
Virology
214:371-378[CrossRef][Medline].
|
| 32.
|
Li, M.,
Y.-H. Xie,
Y.-Y. Kong,
X. Wu,
L. Zhu, and Y. Wang.
1998.
Cloning and characterization of a novel human hepatocyte transcription factor, hB1F, which binds and activates enhancer II of hepatitis B virus.
J. Biol. Chem.
273:29022-29031[Abstract/Free Full Text].
|
| 33.
|
Lo, W.-Y., and L.-P. Ting.
1994.
Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.
J. Virol.
68:1758-1764[Abstract/Free Full Text].
|
| 34.
|
López-Cabrera, M.,
J. Letovsky,
K.-Q. Hu, and A. Siddiqui.
1990.
Multiple liver-specific factors bind to the hepatitis B virus core/pregenomic promoter: trans-activation and repression by CCAAT/enhancer binding protein.
Proc. Natl. Acad. Sci. USA
87:5069-5073[Abstract/Free Full Text].
|
| 35.
|
López-Cabrera, M.,
J. Letovsky,
K.-Q. Hu, and A. Siddiqui.
1991.
Transcriptional factor C/EBP binds to and transactivates the enhancer element II of the hepatitis B virus.
Virology
183:825-829[CrossRef][Medline].
|
| 36.
|
Malpièce, Y.,
M. L. Michel,
G. Carloni,
M. Revel,
P. Tiollais, and J. Weissenbach.
1983.
The gene S promoter of hepatitis B virus confers constitutive gene expression.
Nucleic Acids Res.
11:4645-4654[Abstract/Free Full Text].
|
| 37.
|
Mendel, D. B., and G. R. Crabtree.
1991.
HNF-1, a member of a novel class of dimerizing homeodomain proteins.
J. Biol. Chem.
266:677-680[Free Full Text].
|
| 38.
|
Raney, A. K.,
J. L. Johnson,
C. N. A. Palmer, and A. McLachlan.
1997.
Members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter.
J. Virol.
71:1058-1071[Abstract].
|
| 39.
|
Ryden, T. A., and K. Beemon.
1989.
Avian retroviral long terminal repeats bind CCAAT/enhancer-binding protein.
Mol. Cell. Biol.
9:1155-1164[Abstract/Free Full Text].
|
| 40.
|
Shaul, Y.,
W. J. Rutter, and O. Laub.
1985.
A human hepatitis B viral enhancer element.
EMBO J.
4:427-430[Medline].
|
| 41.
|
Siddiqui, A.,
S. Jameel, and J. Mapoles.
1986.
Transcriptional control elements of hepatitis B surface antigen gene.
Proc. Natl. Acad. Sci. USA
83:566-570[Abstract/Free Full Text].
|
| 42.
|
Siddiqui, A.,
S. Jameel, and J. Mapoles.
1987.
Expression of the hepatitis B virus X gene in mammalian cells.
Proc. Natl. Acad. Sci. USA
84:2513-2517[Abstract/Free Full Text].
|
| 43.
|
Standring, D. N.,
W. J. Rutter,
H. E. Varmus, and D. Ganem.
1984.
Transcription of the hepatitis B surface antigen gene in cultured murine cells initiates within the presurface region.
J. Virol.
50:563-571[Abstract/Free Full Text].
|
| 44.
|
Su, H., and J.-K. Yee.
1992.
Regulation of hepatitis B virus gene expression by its two enhancers.
Proc. Natl. Acad. Sci. USA
89:2708-2712[Abstract/Free Full Text].
|
| 45.
|
Summers, J., and W. S. Mason.
1982.
Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate.
Cell
29:403-415[CrossRef][Medline].
|
| 46.
|
Sureau, C.,
J. L. Romet-Lemonne,
J. I. Mullins, and M. Essex.
1986.
Production of hepatitis B virus by a differentiated human hepatoma cell line after transfection with cloned circular HBV DNA.
Cell
47:37-47[CrossRef][Medline].
|
| 47.
|
Tiollais, P.,
C. Pourcel, and A. Dejean.
1985.
The hepatitis B virus.
Nature
317:489-495[CrossRef][Medline].
|
| 48.
|
Tognoni, A.,
R. Cattaneo,
E. Serfling, and W. Schaffner.
1985.
A novel expression selection approach allows precise mapping of the hepatitis B virus enhancer.
Nucleic Acids Res.
13:7457-7472[Abstract/Free Full Text].
|
| 49.
|
Treinin, M., and O. Laub.
1987.
Identification of a promoter element located upstream from the hepatitis B virus X gene.
Mol. Cell. Biol.
7:545-548[Abstract/Free Full Text].
|
| 50.
|
Tsurimoto, T.,
A. Fujiyama, and K. Matsubara.
1987.
Stable expression and replication of hepatitis B virus genome in an integrated state in a human hepatoma cell line transfected with the cloned viral DNA.
Proc. Natl. Acad. Sci. USA
84:444-448[Abstract/Free Full Text].
|
| 51.
|
Vannice, J. L., and A. D. Levinson.
1988.
Properties of the human hepatitis B virus enhancer: position effects and cell-type nonspecificity.
J. Virol.
62:1305-1313[Abstract/Free Full Text].
|
| 52.
|
Wang, W.-X.,
M. Li,
X. Wu,
Y. Wang, and Z.-P. Li.
1998.
HNF1 is critical for the liver-specific function of HBV enhancer II.
Res. Virol.
149:99-108[CrossRef][Medline].
|
| 53.
|
Wang, Y.,
P. Chen,
X. Wu,
A.-L. Sun,
H. Wang,
Y.-A. Zhu, and Z.-P. Li.
1990.
A new enhancer element, ENII, identified in the X gene of hepatitis B virus.
J. Virol.
64:3977-3981[Abstract/Free Full Text].
|
| 54.
|
Will, H.,
W. Reiser,
T. Weimer,
E. Pfaff,
M. Büscher,
R. Sprengel,
R. Cattaneo, and H. Schaller.
1987.
Replication strategy of human hepatitis B virus.
J. Virol.
61:904-911[Abstract/Free Full Text].
|
| 55.
|
Yaginuma, K.,
Y. Shirakata,
M. Kobayashi, and K. Koike.
1987.
Hepatitis B virus (HBV) particles are produced in a cell culture system by transient expression of transfected HBV DNA.
Proc. Natl. Acad. Sci. USA
84:2678-2682[Abstract/Free Full Text].
|
| 56.
|
Yaginuma, K., and K. Koike.
1989.
Identification of a promoter region for 3.6-kilobase mRNA of hepatitis B virus and specific cellular binding protein.
J. Virol.
63:2914-2920[Abstract/Free Full Text].
|
| 57.
|
Yee, J.-K.
1989.
A liver-specific enhancer in the core promoter region of human hepatitis B virus.
Science
246:658-661[Abstract/Free Full Text].
|
| 58.
|
Yu, X., and J. E. Mertz.
1996.
Promoters for synthesis of the pre-C and pregenomic mRNAs of human hepatitis B virus are genetically distinct and differentially regulated.
J. Virol.
70:8719-8726[Abstract].
|
| 59.
|
Yu, X., and J. E. Mertz.
1997.
Differential regulation of the pre-C and pregenomic promoters of human hepatitis B virus by members of the nuclear receptor superfamily.
J. Virol.
71:9366-9374[Abstract].
|
| 60.
|
Yuh, C.-H., and L.-P. Ting.
1990.
The genome of hepatitis B virus contains a second enhancer: cooperation of two elements within this enhancer is required for its function.
J. Virol.
64:4281-4287[Abstract/Free Full Text].
|
| 61.
|
Yuh, C.-H., and L.-P. Ting.
1991.
C/EBP-like proteins binding to the functional box- and box- of the second enhancer of hepatitis B virus.
Mol. Cell. Biol.
11:5044-5052[Abstract/Free Full Text].
|
| 62.
|
Yuh, C.-H.,
Y.-L. Chang, and L.-P. Ting.
1992.
Transcriptional regulation of precore and pregenomic RNAs of hepatitis B virus.
J. Virol.
66:4073-4084[Abstract/Free Full Text].
|
| 63.
|
Yuh, C.-H., and L.-P. Ting.
1993.
Differentiated liver cell specificity of the second enhancer of hepatitis B virus.
J. Virol.
67:142-149[Abstract/Free Full Text].
|
| 64.
|
Zhang, P.,
A. K. Raney, and A. McLachlan.
1993.
Characterization of functional Sp1 transcription factor binding sites in the hepatitis B virus nucleocapsid promoter.
J. Virol.
67:1472-1481[Abstract/Free Full Text].
|
| 65.
|
Zhang, W.,
J. Zhang,
M. Kornuc,
K. Kwan,
R. Frank, and S. D. Nimer.
1995.
Molecular cloning and characterization of NF-IL3A, a transcriptional activator of the human interleukin-3 promoter.
Mol. Cell. Biol.
15:6055-6063[Abstract].
|
Journal of Virology, February 2000, p. 1241-1251, Vol. 74, No. 3
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
LIU, R.-S., HSIEH, Y.-J., KE, C.-C., CHEN, F.-D., HWU, L., WANG, F.-H., HWANG, J.-J., CHI, C.-W., LEE, C.-H., YEH, S.-H.
(2009). Specific Activation of Sodium Iodide Symporter Gene in Hepatoma Using Alpha-fetoprotein Promoter Combined with Hepatitis B Virus Enhancer (EIIAPA). Anticancer Res
29: 211-221
[Abstract]
[Full Text]
-
Takeji, M., Kawada, N., Moriyama, T., Nagatoya, K., Oseto, S., Akira, S., Hori, M., Imai, E., Miwa, T.
(2004). CCAAT/Enhancer-Binding Protein {delta} Contributes to Myofibroblast Transdifferentiation and Renal Disease Progression. J. Am. Soc. Nephrol.
15: 2383-2390
[Abstract]
[Full Text]
-
Xu, P.-L., Liu, Y.-Q., Shan, S.-F., Kong, Y.-Y., Zhou, Q., Li, M., Ding, J.-P., Xie, Y.-H., Wang, Y.
(2004). Molecular Mechanism for the Potentiation of the Transcriptional Activity of Human Liver Receptor Homolog 1 by Steroid Receptor Coactivator-1. Mol. Endocrinol.
18: 1887-1905
[Abstract]
[Full Text]
-
Ohkawa, K., Ishida, H., Nakanishi, F., Hosui, A., Ueda, K., Takehara, T., Hori, M., Hayashi, N.
(2004). Hepatitis C Virus Core Functions as a Suppressor of Cyclin-dependent Kinase-activating Kinase and Impairs Cell Cycle Progression. J. Biol. Chem.
279: 11719-11726
[Abstract]
[Full Text]
-
Lin, S.-J., Shu, P.-Y., Chang, C., Ng, A.-K., Hu, C.-p.
(2003). IL-4 Suppresses the Expression and the Replication of Hepatitis B Virus in the Hepatocellular Carcinoma Cell Line Hep3B. J. Immunol.
171: 4708-4716
[Abstract]
[Full Text]
-
Ozkurt, I. C., Tetradis, S.
(2003). Parathyroid Hormone-induced E4BP4/NFIL3 Down-regulates Transcription in Osteoblasts. J. Biol. Chem.
278: 26803-26809
[Abstract]
[Full Text]
-
Gilbert, S., Galarneau, L., Lamontagne, A., Roy, S., Bélanger, L.
(2000). The Hepatitis B Virus Core Promoter Is Strongly Activated by the Liver Nuclear Receptor Fetoprotein Transcription Factor or by Ectopically Expressed Steroidogenic Factor 1. J. Virol.
74: 5032-5039
[Abstract]
[Full Text]
-
Sun, C.-T., Lo, W.-Y., Wang, I.-H., Lo, Y.-H., Shiou, S.-R., Lai, C.-K., Ting, L.-P.
(2001). Transcription Repression of Human Hepatitis B Virus Genes by Negative Regulatory Element-binding Protein/SON. J. Biol. Chem.
276: 24059-24067
[Abstract]
[Full Text]