Previous Article | Next Article ![]()
Journal of Virology, January 2000, p. 764-772, Vol. 74, No. 2
Institut für Virologie, Zentrum
für Mikrobiologie und Hygiene, Philipps-Universität
Marburg, 35037 Marburg, Germany
Received 15 June 1999/Accepted 20 October 1999
During the late phase of adenovirus infection, viral mRNA is
efficiently transported from the nucleus to the cytoplasm while most
cellular mRNA species are retained in the nucleus. Two viral proteins,
E1B-55 kDa and E4orf6, are both necessary for these effects. The E4orf6
protein of adenovirus type 5 binds and relocalizes E1B-55 kDa, and the
complex of the two proteins was previously shown to shuttle
continuously between the nucleus and cytoplasm. Nucleocytoplasmic
transport of the complex is achieved by a nuclear export signal (NES)
within E4orf6. Mutation of this signal sequence severely reduces the
ability of the E1B-55 kDa-E4orf6 complex to leave the nucleus. Here,
we examined the role of functional domains within E4orf6 during virus
infection. E4orf6 or mutants derived from it were transiently
expressed, followed by infection with recombinant adenovirus lacking
the E4 region and determination of virus yield. An arginine-rich
putative alpha helix near the carboxy terminus of E4orf6 contributes to
E1B-55 kDa binding and relocalization as well as to the synthesis of
viral DNA, mRNA, and proteins. Further mutational analysis revealed
that mutation of the NES within E4orf6 considerably reduces its ability
to support virus production. The same effect was observed when nuclear
export was blocked with a competitor. Further, a functional NES within E4orf6 contributed to the efficiency of late virus protein synthesis and viral DNA replication, as well as total and cytoplasmic
accumulation of viral late mRNA. Our data support the view that
NES-mediated nucleocytoplasmic shuttling strongly enhances most, if not
all, intracellular activities of E4orf6 during the late phase of
adenovirus infection.
A number of viruses that replicate
in the nucleus of the cell have devised specialized mechanisms that
ensure efficient export of viral RNA from the nucleus to the cytoplasm.
Such viruses include the human immunodeficiency virus (HIV) and other
lentiviruses (9, 10, 37), simple retroviruses
(6), influenza virus (43), hepatitis B virus
(23, 27), and adenovirus. In the late phase of infection
with adenovirus type 5, viral mRNA is efficiently transported to the
cytoplasm but, simultaneously, most cellular mRNA molecules are
retained in the nucleus of the cell (1, 3, 46).
Two proteins encoded by adenovirus type 5 are known to be required for
the modulation of mRNA transport: E1B-55 kDa and E4orf6 (E4-34 kDa)
(1, 18, 46, 56). These proteins form a specific complex
within infected (54) and transiently transfected
(17) cells. The E4orf3 protein of adenovirus type 5 also
colocalizes with E1B-55 kDa. However, E1B-55 kDa preferentially
associates with E4orf6 when all three proteins are present in an
infected or transfected cell (33, 34). When E1B-55 kDa is
expressed by transient or stable transfection, it is mostly localized
in cytoplasmic clusters (64, 65). However, in
adenovirus-infected cells, several localization patterns were
identified in addition to this cytoplasmic location (45).
Most notably, E1B-55 kDa colocalizes with E4orf6 in the periphery of
viral replication centers within the nucleus. It was therefore
suggested that the two proteins may be directly involved in the
transport of viral mRNA from these replication centers to the cytoplasm
(45). Upon transient coexpression of E1B-55 kDa with E4orf6,
both proteins are evenly distributed over the nucleus, arguing that
E4orf6 relocalizes E1B-55 kDa from the cytoplasm to the nucleus
(17). However, even though the steady-state localization of
both proteins is almost exclusively nuclear under these circumstances,
the complex of E1B-55 kDa and E4orf6 continuously shuttles between the
nucleus and cytoplasm, as has been shown by heterokaryon assays
(8). While the two proteins can exit the nucleus when
expressed together, neither of them is able to undergo nuclear export
in the absence of the other. Nuclear export is driven by a leucine-rich
nuclear export signal (NES) within E4orf6. E1B-55 kDa apparently
inactivates a nuclear retention signal upon association with E4orf6,
resulting in nuclear export of the two proteins. Given the fact that
both proteins are required to modulate mRNA transport during adenovirus infection, along with the finding that they undergo nuclear export, it
is tempting to speculate that a functional NES might be contributing to
the efficient export of viral mRNA, thus supporting virus replication. To test this hypothesis, we assayed whether or not the export function
of E4orf6 contributes to the efficiency of virus production and, if so,
what stages of the infectious cycle depend on E4orf6 export. Our
results suggest that nuclear export of E4orf6 contributes to several
steps in virus production, including DNA replication, mRNA
accumulation, and a shift in distribution of late viral mRNA from the
nucleus to the cytoplasm.
Cell culture.
HeLa cells were obtained from the American
Type Culture Collection and maintained in Dulbecco's modified Eagle
medium (DMEM) containing 10% fetal bovine serum (FBS).
Plasmids.
Expression plasmids for E4orf6 and E1B-55 kDa as
well as rex chimeras have been described previously (8). All
E4orf6 mutants were generated by site-directed mutagenesis (Quikchange;
Stratagene). Thereby, the coding sequences for the amino acids to be
deleted were replaced by the sequence GGCGCC to generate the
mutants E4orf6 Transient transfections.
For electroporation, 0.4 ml of a
HeLa cell suspension in DMEM-10% FCS (4 × 106
cells/ml) was subjected to a pulse of 230 V in a cuvette with 0.4-cm
gap width, with the resistance set to 200 Immunofluorescence.
Cells were seeded on plastic slides
(Nunc) suitable for microscopy and then infected as described below or
transfected with Superfect. Transfected or infected cells were fixed
with paraformaldehyde (4% in phosphate-buffered saline [PBS]; 15 min), permeabilized with Triton X-100 (0.2% in PBS; 25 min), and
incubated with antibody as described previously (7). The
E2A-72 kDa DNA binding protein was stained with a mouse monoclonal
antibody (clone B8-6; gift from T. Shenk). To detect E4orf6, the murine
monoclonal antibody RSA3 (45) was used. Hemagglutinin
(HA)-tagged E1B-55 kDa was stained with a polyclonal rabbit antibody to
the HA tag (Santa Cruz Biotechnology). Primary mouse antibodies were
visualized by secondary antibodies coupled to fluorescein
isothiocyanate (Jackson Laboratory). Primary rabbit antibodies were
detected by a Texas Red-labeled secondary antibody (Jackson
Laboratory). Prior to being mounted (Fluoprep mounting medium;
bioMérieux), the cell nuclei were briefly stained with
4',6'-diamidino-2-phenylindole (DAPI).
Immunoprecipitation.
E4orf6 and E4orf6 Complementation of virus growth.
HeLa cells were transiently
transfected with E4orf6 expression plasmids by electroporation.
Electroporated cells (800,000) were then seeded in a 3.5-cm-diameter
dish for 24 h. Subsequently, the cells were washed with PBS and
then overlayed with 800,000 infectious units of the recombinant
adenovirus 366, which lacks the entire E4 region, in 500 µl of DMEM
without serum. After 3 h of gentle rocking in an incubator, the
cells were washed again with PBS and further incubated in DMEM-10%
FBS. After another 48-h incubation period, the cells were harvested in
PBS and lysed by three cycles of freezing and thawing. To determine the
yield of virus, a dilution series of the lysate was made in DMEM and a
fresh monolayer of HeLa cells was infected with the dilutions as
described above. Twenty-four hours after infection, the cells were
fixed and stained with a monoclonal antibody (B8-6) to the E2A-72 kDa
DNA binding protein. The cells were stained with DAPI in parallel, and
the ratio of infected cells to the total cell count was determined.
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Nuclear Export Signal within the E4orf6 Protein of Adenovirus
Type 5 Supports Virus Replication and Cytoplasmic Accumulation of
Viral mRNA
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
13-21, E4orf6
22-31, E4orf6
225-232, and
E4orf6
264-272. The sequences of the corresponding oligonucleotides
employed for mutagenesis were GGCATGACACTAGGCGCCCGCACTCCGTACAG,
CTCGGTTGTCTCGGGGCGCCTTTGAGACAGAAACC, GTGGTGCTGTGCTGCGGCGCCATCAGGGTGCGCTGC, and
GCCATGTTGTATTCCGGCGCCTTTATTCGCGCGCTG, respectively.
The plasmids pGemE4orf6 and pGemE4orf6
225-232 were generated
by excising the E4orf6 coding regions from the expression plasmids
described above with BamHI and ligating them into the vector
pGem7Zf(+) (Promega) (previously linearized with the same enzyme) in an
orientation that allows the transcription of RNA in the sense direction
from the T7 promoter.
and the capacitance set
to 950 µF. Then, 0.2 ml of the suspension was seeded on a 3.5-cm-diameter cell culture dish in 2 ml of DMEM-10% FCS.
Transfections with Superfect (Qiagen) were done as recommended by the manufacturer.
225-232 were
prepared with pGemE4orf6 and pGemE4orf6
225-232, respectively, by
transcription and translation in vitro with T7 RNA polymerase and
rabbit reticulocyte lysate (Promega). The reticulocyte lysate was
incubated with lysates from HeLa cells or 293 cells (the latter
constitutively expressing E1B-55 kDa) and immunoprecipitated with an
antibody against E1B-55 kDa (clone 2A6 [55]), as
described previously (51). The precipitated proteins were
resolved on a 10% polyacrylamide gel, followed by autoradiography.
Assessment of late protein expression. HeLa cells were transfected and infected with 366 virus as described above. Eighteen hours after infection, the cells were radiolabeled with [35S]Met and [35S]Cys (Promix, Amersham) for 3 h and harvested in 0.6 ml of radioimmunoprecipitation assay (RIPA) buffer (20 mM Tris-HCl [pH 7.6], 150 mM NaCl, 10 mM EDTA, 1% Triton X-100, 1% desoxycholate, 0.1% sodium dodecyl sulfate [SDS]). The viral hexon protein was immunoprecipitated as follows. After preclearing the lysate with protein A-Sepharose (Pharmacia), incubation with a monoclonal antibody (gift from J. Flint) to hexon was allowed to proceed for 3 h. Protein A-Sepharose (10-µl packed volume) was added for 30 min, followed by three washing steps in RIPA buffer and two additional washing steps in SNNTE (50 mM Tris-HCl [pH 7.6], 500 mM NaCl, 5 mM EDTA, 5% sucrose, 1% Nonidet P-40). The precipitated protein was separated on an SDS-polyacrylamide gel, followed by autoradiography.
Detection of virus DNA. HeLa cells were transfected and infected with 366 virus as described above. At various time points after infection, the cells were harvested and DNA was extracted (Qiagen). The DNA was treated with HindIII and separated on a 0.8% agarose gel, followed by transfer to nylon. The blot was hybridized to a digoxigenin-labeled probe derived from the E1B region of adenovirus type 5, followed by detection with an antidigoxigenin antibody (Roche).
Cell fractionation. HeLa cells were transfected and infected with 366 virus as described above. At various time points after infection, the cells were scraped off the dish in PBS and pelleted. After resuspension in fractionating buffer (10 mM Tris-HCl [pH 7.6], 150 mM NaCl, 1.5 mM MgCl2, 0.5% Nonidet P-40; 100 µl was used to suspend 800,000 cells), the cells were subjected to vigorous shaking for 5 min, followed by fractionation. The supernatant was used as the cytoplasmic fraction. After one washing step with fractionating buffer, the pellet was defined as the nuclear fraction.
RNase protection assay. RNA was extracted from total cell pellets or fractions (see above) with Trizol reagent (Life Technologies) and hybridized to a radioactively labeled antisense probe to the viral L5 region (generated with a plasmid obtained from K. Leppard). Hybridization and subsequent RNase digestion were carried out with a premanufactured system (Ambion), followed by denaturing gel electrophoresis and autoradiography. Quantitations were performed with a BioImager system (Fuji).
Immunoblots. Proteins were separated on SDS-10% polyacrylamide gels and transferred to polyvinylidene difluoride, followed by incubation with antibodies in PBS containing 5% milk powder and 0.5% Tween 20 and chemiluminescent detection (Pierce) of peroxidase-coupled secondary antibody (Jackson Laboratory).
| |
RESULTS |
|---|
|
|
|---|
Mapping of a region within E4orf6 that is required for intracellular colocalization with E1B-55 kDa. To map the activities of E4orf6, several expression plasmids expressing mutants of E4orf6 were created. In these mutants, small amino acid deletions were introduced at residues that were predicted to be exposed to the surface by a computer-based secondary structure calculation (48). These expression plasmids were transfected into HeLa cells to yield protein amounts comparable to that of wild-type E4orf6, as determined by Western blot analysis (Fig. 1A). Upon deletion of amino acids 22 to 31, the protein was no longer detectable (Fig. 1A, lane 3) with a polyclonal antibody raised against an E4orf6-derived peptide (generous gift from P. Branton) but did efficiently relocalize E1B-55 kDa (see below), arguing that the deleted region is part of the epitope recognized by this antibody. Next, we tested whether these mutants of E4orf6 were still able to relocalize E1B-55 kDa, as was shown previously for wild-type E4orf6 (8, 17). Expression plasmids for E4orf6 and E1B-55 kDa were transiently transfected into HeLa cells, followed by simultaneous immunostaining of the two proteins. All but one of these mutants retained the ability to relocalize E1B-55 kDa to the nucleus (Fig. 1B, a to j). Also, the previously described point mutations that modify the nuclear export properties of E4orf6 (L90A and I92A; R248E; L90A, I92A, and R248E [8]) did not abolish E1B-55 kDa relocalization (Fig. 1B, k to r). Only the deletion of amino acids 225 to 232 eliminated this activity (Fig. 1B, d and i). This deletion removes a putative amphipathic and arginine-rich alpha helix from E4orf6 (44). In parallel, the E4orf6/7 protein failed to colocalize detectably with E1B-55 kDa (Fig. 1B, o and t). E4orf6/7 shares the N-terminal 58 amino acids with E4orf6 but contains a different C-terminal portion. Taken together, these results argue that the carboxy-terminal arginine-rich alpha helix within E4orf6 is required for the relocalization of E1B-55 kDa to the nucleus, confirming recently published data (44).
|
E4orf6 employs amino acids 225 to 232 to associate with E1B-55 kDa
in vitro.
The results described above strongly suggest that amino
acids 225 to 232 within E4orf6 are required to allow relocalization of
E1B-55 kDa. This seems contrary to a previous study (53) where the interaction of E1B-55 kDa and E4orf6 was analyzed by immunoprecipitation, mapping the region of interaction with E1B-55 kDa
exclusively to the amino-terminal portion of E4orf6. To further explore
this issue, E4orf6 and E4orf6
225-232 were generated by transcription
and translation in vitro (Fig. 2, lanes 1 and 2). The proteins were incubated with a lysate from 293 cells that contain E1B-55 kDa (lanes 5 and 6). As a control, parallel experiments were carried out with a lysate from HeLa cells that do not contain adenoviral proteins (lanes 3 and 4). An antibody to E1B-55 kDa was
added to the mixtures, and this antibody was then used for immunoprecipitation with protein A-Sepharose beads. The precipitated proteins were separated on an SDS-polyacrylamide gel, followed by
autoradiography. In this experiment, considerable amounts of E4orf6
were precipitated in the presence of E1B-55 kDa (lane 5) but not in the
absence of E1B-55 kDa (lane 3). In contrast, E4orf6
225-232 largely
failed to coprecipitate with E1B-55 kDa (lane 6). Thus, residues 225 to
232 within E4orf6 are either necessary for, or at least strongly
contribute to, the interaction between E1B-55 kDa and E4orf6.
|
Virus growth supported by E4orf6 and mutants. Next, we asked how these different mutations within E4orf6 might affect the growth of adenovirus. To test this, an assay that was previously established to assess the role of different E4 proteins in adenovirus infection was used (30).
Expression plasmids for E4orf6 and mutants were transiently transfected into HeLa cells by electroporation. Cells (800,000) were seeded in a 3.5-cm-diameter dish and, 24 h later, infected with the defective adenovirus 366 (lacking the entire E4 region [18]) at a multiplicity of infection of 1. This virus is unable to replicate at low multiplicities of infection (24). However, the presence of transiently expressed E4orf6 enables the virus to replicate and leads to the production of new virus particles. After further incubation for 48 h, the cells were harvested in PBS and lysed by three cycles of freezing and thawing. The lysate was then diluted with DMEM and applied to a fresh monolayer of HeLa cells, and infected cells were subsequently detected with an antibody against the E2A DNA binding protein. Expression of this protein was previously shown not to be reduced by the deletion of the E4 region (38). The amount of cells staining positive for E2A in the assay involving wild-type E4orf6 was arbitrarily set to 100%, and the other values were normalized accordingly. This assay was performed with all the mutants described above. Most mutations resulted in little or no detectable loss in virus production (Fig. 3A). However, the same mutant E4orf6
225-232 that no longer relocalized E1B-55 kDa also failed to
support virus production (lane 4), arguing that the association of
E4orf6 with E1B-55 kDa may considerably contribute to efficient
adenovirus production. Most notably, the E4orf6 protein with a mutation
in the NES (L90A and I92A) was compromised in its ability to support virus replication (lane 6). While this mutation did not completely abrogate virus replication, it did result in a considerable reduction of virus yield. This led us to hypothesize that the nuclear export function of E4orf6 may affect virus replication. However, this experiment does not exclude the possibility that a different function of E4orf6 that contributes to virus replication might be affected by
the mutation involving the changes L90A and I92A simultaneously with
the NES function.
|
Export blockage suppresses E4orf6 function in virus production. To further evaluate the concept that nuclear export of E4orf6 contributes to virus replication, we used an export competitor (Fig. 4A) that was previously shown to block the activity of leucine-rich NESs (8, 29, 32, 49). This competitor was derived from a fragment of the human T-cell leukemia virus type 1 rex protein that contains a functional NES. This fragment was fused to the nuclear import signal (nuclear localization signal) of simian virus 40 T antigen. The chimeric protein expressed from this construct undergoes rapid nuclear export and import, and it presumably exhausts the activity of one or several components of the nuclear export machinery. As a control, we used a similar construct with a mutation in the NES of the rex fragment. An expression plasmid for beta-galactosidase served as an additional control. These three plasmids were each cotransfected with an expression plasmid for wild-type E4orf6 (Superfect; Qiagen), followed by infection with the E4-less 366 virus and quantitation of newly synthesized virus. Compared to the controls, the export competitor reduced the yield of virus (Fig. 4B; compare lane 1 with lanes 2 and 3). This argues that it is indeed a nuclear export function that contributes to the enhancement of virus production by E4orf6.
|
Residues 225 to 232 and the NES within E4orf6 contribute to viral
protein synthesis.
Given the loss in virus production that is
induced by removal of the residues 225 to 232 from E4orf6 or a mutation
in the NES of E4orf6, we attempted to find out what step in virus
replication might be relying on these domains. Therefore, we first
determined if the reduction in virus yield is accompanied by a loss in
late viral protein synthesis when residues 225 to 232 or the NES within E4orf6 is mutated. To this end, cells were transfected with E4orf6 expression plasmids or the control plasmid. After infection with E4-less 366 virus, the cells were harvested and the amount of hexon
protein (a structural protein encoded by the L3 region of the viral
genome) was determined by radioactive labeling of the cellular
proteins, followed by immunoprecipitation of hexon. As shown in Fig.
5A, E4orf6 supported late protein
production (lane 1), whereas a control plasmid did not (lane 4).
Notably, a mutation in the NES of E4orf6 (L90A and I92A) led to a
reduction in the amount of hexon (lane 2). In the presence of
E4orf6
225-232, no hexon protein could be detected (lane 3).
Similarly, when the rex-derived export competitor NLSrex was
coexpressed with E4orf6, hexon accumulation was suppressed compared to
that resulting from the transfection of control plasmids (Fig. 5B).
Thus, the association of E4orf6 with E1B-55 kDa as well as the NES
function of E4orf6 seem to contribute to the efficiency of late virus
protein synthesis.
|
The NES within E4orf6 supports viral DNA replication.
Besides
the expression of late genes, the replication of viral DNA is a
prominent step after entry into the late phase of the infectious cycle.
Therefore, we determined whether DNA synthesis is supported by the NES
function of E4orf6. To test this, HeLa cells were transfected to
express wild-type or mutant E4orf6 and infected with 366 virus. At
three different time points, the cells were harvested and viral DNA was
detected by Southern blotting. As shown in Fig.
6A, viral DNA did not accumulate in the
absence of E4orf6 (lanes 1 to 3) or in the presence of the mutant
E4orf6
225-232, which does not detectably interact with E1B-55 kDa
(lanes 4 to 6). In contrast, both E4orf6 and E4orf6L90A/I92A supported
viral DNA synthesis. However, viral DNA accumulated to greater amounts in the presence of wild-type E4orf6 than in the presence of the NES
mutant (compare lanes 10 to 12 with 7 to 9). In parallel, the export
competitor NLSrex but not its mutant considerably suppressed DNA
production when cotransfected with E4orf6 (Fig. 6B). Hence, a
functional NES within E4orf6 ultimately leads to enhanced production of
viral DNA.
|
The NES within E4orf6 increases the overall accumulation of viral
mRNA.
Finally, we tested the effects of E4orf6 and its NES on the
accumulation and intracellular distribution of late viral mRNA. To this
end, HeLa cells were transfected and infected as described above,
followed by an RNase protection assay to quantitate the L5 late mRNA
(this RNA species' accumulation and export were previously shown to be
most strongly dependent on the expression of E1B-55 kDa protein
[35]). Considerably more RNA accumulated in
E4orf6-transfected cells than in cells expressing the NES mutant (Fig.
7A; compare lanes 1 to 3 and 4 to 6).
Quantitation of the radiation intensities revealed a roughly 50-fold
difference between the amounts of RNA that accumulated in the presence
of wild-type and NES mutant E4orf6 at 72 h postinfection (Fig. 7B,
lanes 3 and 6). When E4orf6
225-232 was expressed, no late viral mRNA
could be detected (Fig. 7A, lanes 7 to 9), similar to the control with
no E4orf6 protein (lanes 10 to 12). These results argue that
interaction of E4orf6 with E1B-55 kDa and the NES within E4orf6 plays
important roles in the overall accumulation of late viral mRNA.
|
The NES within E4orf6 supports the accumulation of viral mRNA in
the cytoplasm.
Given the differences in RNA accumulation, we next
determined if the intracellular distribution of mRNA might also be
affected by the NES function of E4orf6. Therefore, after transfection
and infection of HeLa cells, we harvested the cells at different time points, followed by separation into nuclear and cytoplasmic fractions. To verify the accuracy of cell fractionation, cytoplasmic and nuclear
proteins were detected by immunoblot analysis in each fraction. While
the cytoplasmic
-tubulin protein was detected exclusively in the
cytoplasmic fraction, not in the nuclear fraction (Fig.
8A; compare lanes 2 and 3, upper panel),
the reverse was true for the nuclear lamin proteins (lamin a and lamin
c) (Fig. 8A, lanes 2 and 3, lower panel). This shows that the
separation procedure efficiently separates cytoplasmic from nuclear
material. The amount of L5 RNA in each fraction was measured by RNase
protection assay, and the band intensities were quantified with a
BioImager. The values obtained from the cytoplasmic fractions were
divided by the values obtained from the corresponding nuclear
fractions. The resulting numbers are shown graphically in Fig. 8C. At
72 h after infection, the ratio of cytoplasmic to nuclear RNA was about 4 in E4orf6-transfected cells but only between 1 and 1.5 upon
mutation of the NES (Fig. 8B and C). Concerning the intracellular distribution of viral mRNA, the effects of an export competitor such as
NLSrex could not be successfully determined (data not shown). This was
presumably due to the fact that at late times after transfection and
infection (72 h), only small amounts of NLSrex were still expressed,
resulting in insufficient blockage of export. Nonetheless, the results
presented here argue that the NES function of E4orf6 specifically
enhances the cytoplasmic accumulation of late viral mRNA.
|
| |
DISCUSSION |
|---|
|
|
|---|
Our data show that the ability of E4orf6 to support adenovirus replication cosegregates with two necessary functions: intracellular association with E1B-55 kDa seems to be required for E4orf6-driven virus production, while nuclear export of E4orf6 apparently increases the yield of viral particles. The latter phenomenon correlates with the contribution of E4orf6 and its export signal to late protein synthesis and DNA replication, as well as the accumulation of total and cytoplasmic mRNA. These data support the view that the NES within E4orf6 is of considerable importance for virus replication and may enhance the nucleocytoplasmic transport of late viral mRNA.
Our mapping studies on the relocalization of E1B-55 kDa by E4orf6
reveal that a deletion of residues 225 to 232 within E4orf6 abolishes
the protein's ability to relocalize E1B-55 kDa to the nucleus.
Accordingly, the E4orf6/7 protein does not detectably colocalize with
E1B-55 kDa protein either. E4orf6/7 shares the amino-terminal portion
with E4orf6 but differs from it in the C-terminal part, further
supporting the concept that the C-terminal portion of E4orf6 is
required to relocalize E1B-55 kDa. This observation is in agreement
with a recent report (44). Earlier mapping studies that used
immunoprecipitation to detect interactions between E1B-55 kDa and
E4orf6 (53) came up with a different conclusion. In these
studies, only the amino-terminal portion common to E4orf6 and E4orf6/7
was required to detect association with E1B-55 kDa and no gross
difference between the binding efficiency of full-length E4orf6 and
that of E4orf6/7 was reported. In contrast, our results show that
wild-type E4orf6 binds to E1B-55 kDa at least more efficiently than
E4orf6
225-232. While we cannot fully explain the apparent discrepancy, we suspect that the amino-terminal portion of E4orf6 may
have some ability to associate with E1B-55 kDa under nonstringent conditions or in the presence of a large excess of E1B-55 kDa. In any
case, our immunofluorescence and immunoprecipitation studies strongly
suggest that the C-terminal portion of E4orf6 at least enhances the
efficiency of the interaction with E1B-55 kDa.
At first glance, it was unexpected that a mutation of the NES within E4orf6 had multiple effects on the infectious cycle. As an explanation, one could argue that the region of E4orf6 that contains the NES might carry out functions in addition to nuclear export. However, this possibility is rendered unlikely by the fact that expression of an export competitor had effects similar to those of a mutation of the NES. Therefore, we favor a second possibility: a defect in the nuclear export of E4orf6 may result in a defect of mRNA transport. This in turn can be expected to reduce late protein synthesis and the production of virus particles.
It seems surprising that differences in late protein synthesis and DNA replication were observed as early as 24 h after infection when wild-type E4orf6 was compared with the NES mutant protein, while clear differences in mRNA distribution were only detected at 72 h postinfection. Similarly, the E1B-55 kDa protein was previously shown to affect the cytoplasmic accumulation of viral mRNA only at such late time points (35). A possible explanation for this phenomenon is that the E1B-55 kDa-E4orf6 complex may affect intranuclear mRNA transport and processing steps in addition to the nucleocytoplasmic distribution of mRNA. Such intranuclear transport and/or processing may be influenced by E4orf6 and its NES at far earlier time points than those at which the nucleocytoplasmic distribution is affected. Indeed, an influence of E4orf6 on the processing of viral mRNA was previously reported (41, 42). Any differences in the intranuclear distribution of mRNA would not be detected upon fractionation into nuclear and cytoplasmic fractions. mRNA transport between intranuclear compartments and its dependence on E1B-55 kDa have been proposed previously (35). By analogy, the temporally dissociated expression of Rev-responsive HIV RNA and the HIV Rev protein results in a failure of mRNA export, arguing that Rev may affect intranuclear transport steps in addition to nucleocytoplasmic transport (28). Further, it was recently reported that Rev not only enhances the export of incompletely spliced HIV mRNA but also modulates intracellular processing steps, such as mRNA splicing and polyadenylation (26). A similar scenario may apply to adenovirus and its mRNA transport modulators.
In our experiments, we have blocked the nuclear export activity of E4orf6 either by point mutation or by a chimeric protein that acts as a competitor for rev-mediated export. Another way of blocking rev-like nuclear export consists of the use of the drug leptomycin, which disrupts the interaction between leucine-rich export signals and their receptor, exportin 1 (11, 13, 40, 61). We have evaluated the effects of leptomycin B on virus replication in our experimental system. However, the drug was considerably toxic to HeLa cells, and it could not be applied for the time required for virus replication (18 to 72 h) without nonspecifically suppressing viral growth simply by killing the cells (data not shown). Therefore, we did not base our studies on the effects of leptomycin B. It is certainly advisable to take these toxic effects of the drug into consideration when using it in other experimental systems, and in particular when longer incubations of cells with the drug are required.
While it seems clear that the nuclear export function of E4orf6 is involved in virus replication and cytoplasmic RNA accumulation, the mechanism by which E4orf6, along with E1B-55 kDa, affects mRNA distribution remains to be elucidated. Intriguingly, E1B-55 kDa turned out to have RNA binding activity, leading to the hypothesis that direct contacts between E1B-55 kDa and viral RNA may allow RNA export (22). Possibly, the complex of E1B-55 kDa and E4orf6 binds viral mRNA, followed by nucleocytoplasmic export of the entire protein-RNA compound. Since the tripartite leader region of late viral mRNA was shown to enhance RNA export in infected cells (25), one role of this RNA element may consist of stabilizing such RNA-protein contacts.
However, the idea that the E1B-55 kDa-E4orf6 complex might directly act as a carrier for viral mRNA, like the HIV Rev protein, is almost certainly simplistic. First, the RNA binding activity of E1B-55 kDa could not be shown to be specific for the tripartite leader region common to all late viral mRNA molecules (22). Further, even cellular mRNA sequences, when expressed by virus DNA, were found to undergo nucleocytoplasmic transport with characteristics similar to those of viral mRNA, albeit with lower efficiency than tripartite-leader-containing RNA (25, 62). Most importantly, the model describing the E1B-55 kDa and E4orf6 proteins as RNA carriers does not provide an explanation for the fact that cellular mRNA molecules are retained in the nucleus during adenovirus infection. The simultaneous transport block on cellular mRNA and enhanced export of viral mRNA suggest that the viral proteins may bind a cellular factor that is required for RNA export. Such a factor would then be available for export of viral mRNA but would no longer be at the disposition of cellular mRNA. This concept is even more intriguing given the observation that a modified E1B-55 kDa protein targeted to the nucleus is able to inhibit mRNA export in the yeast S. cerevisiae and may thus inactivate an essential mRNA export factor (36). The existence of an export factor that is targeted by E1B-55 kDa-E4orf6 was previously postulated (8, 45), and a candidate protein was recently identified (14) and termed E1B-AP5. E1B-AP5 is strongly homologous to the hnRNP U protein that is known to be associated with mRNA. It was therefore proposed that the E1B-55 kDa-E4orf6 complex might associate with viral mRNA through E1B-AP5 and block the export of cellular mRNA by removing E1B-AP5 from the sites of cellular mRNA production (14). While this model continues to be attractive, our unpublished observations suggest that other cellular transport factors may be contacted by E1B-55 kDa as well. Thus, it seems conceivable that a number of cellular mRNA transporters can be targeted by the E1B-55 kDa-E4orf6 complex. Future studies are aimed at the identification and characterization of this set of proteins.
Why does the E4orf6 protein support virus growth even in the absence of a functional export signal? Possibly, some other functions of E4orf6 may be retained in the NES mutant, contributing to virus production. Such functions of E4orf6 may be related to the modulation of RNA splicing (4, 39) or the avoidance of concatemer formation between viral genomic DNA molecules (60). Alternatively, the complex of E1B-55 kDa and E4orf6 may support mRNA transport, to some extent at least, between intranuclear compartments even in the absence of a functional NES.
Apparently, there is some overlap in the E4 gene products' ability to support virus replication. While a recombinant virus lacking the entire E4 region is virtually unable to replicate at low multiplicities of infection, the orf3 and orf6 proteins are each individually capable of rescuing the defect to some extent, either when the orf3 or the orf6 gene is placed into the genome of an otherwise E4-less virus (24) or when they are transiently expressed (30). In our experiments, the orf3 proteins showed far weaker activity in supporting virus replication than orf6 proteins (data not shown), in accordance with earlier reports (24, 30). Possibly, E4orf3 can take over some of the functions carried out by E4orf6 during infection, such as the modulation of mRNA splicing (39), but fails to fulfil other functions, such as mediating mRNA transport.
Besides RNA transport, another well-characterized function of E1B-55 kDa and E4orf6 consists of the inactivation and destabilization of the p53 tumor suppressor protein (47, 51, 57, 63). Important questions for future studies will be whether these seemingly different activities are interrelated and, if so, what biochemical mechanism connects them. These questions become even more intriguing given the fact that E1B-55 kDa's role in virus replication apparently depends on the phase in the cell cycle at the time of infection (15).
The cellular p53 antagonist mdm2 also contains a NES and shuttles between the nucleus and cytoplasm. While the NES of mdm2 contributes to the intracellular degradation of p53, at least in some cell types (12, 50, 58), p53 degradation was detected in the presence of E1B-55 kDa and E4orf6 even when the NES of E4orf6 was mutated (51; our unpublished observations). Therefore, for adenovirus proteins, the link between the export function of E1B-55 kDa-E4orf6 and p53 degradation may not simply consist of the ability to carry p53 to the cytoplasm.
Mapping studies on the E1B-55 kDa protein are under way to determine whether or not its function in mRNA transport can be separated from its ability to bind p53. Such mutants might be of interest in designing viruses that selectively infect and destroy tumor cells, such as dl1520 (2), which was later renamed onyx-015 (5). While the growth of such a virus does not necessarily depend on the p53 status in cultured cells (16, 19, 20, 52, 59), it seems to be restricted to tumor cells in the context of the entire organism (21, 31). A further understanding of E1B-55 kDa's different functions and possibly their selective deletion may ultimately help to develop improved versions of such therapeutic viruses, in addition to providing new insights into growth regulation and mRNA transport.
| |
ACKNOWLEDGMENTS |
|---|
We thank H.-D. Klenk for generous support, C. König and S. Ristea for helpful discussions, T. Shenk for recombinant viruses, P. Branton, J. Flint, and T. Shenk for antibodies, and K. Leppard and C. Caravokyri for plasmids.
This work was supported by the German Research Foundation and the P. E. Kempkes foundation. M.D. was a recipient of the Stipendium für Infektionsbiologie of the German Cancer Research Center.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institut für Virologie, Zentrum für Mikrobiologie und Hygiene, Philipps-Universität Marburg, Robert Koch Str. 17, 35037 Marburg, Germany. Phone: 49 6421 28 4318. Fax: 49 6421 28 8962. E-mail: dobbelst{at}mailer.uni-marburg.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Babiss, L. E.,
H. S. Ginsberg, and J. E. Darnell, Jr.
1985.
Adenovirus E1B proteins are required for accumulation of late viral mRNA and for effects on cellular mRNA translation and transport.
Mol. Cell. Biol.
5:2552-2558 |
| 2. | Barker, D. D., and A. J. Berk. 1987. Adenovirus proteins from both E1B reading frames are required for transformation of rodent cells by viral infection and DNA transfection. Virology 156:107-121[CrossRef][Medline]. |
| 3. | Beltz, G. A., and S. J. Flint. 1979. Inhibition of HeLa cell protein synthesis during adenovirus infection. Restriction of cellular messenger RNA sequences to the nucleus. J. Mol. Biol. 131:353-373[CrossRef][Medline]. |
| 4. |
Berget, S. M.,
C. Moore, and P. A. Sharp.
1977.
Spliced segments at the 5' terminus of adenovirus 2 late mRNA.
Proc. Natl. Acad. Sci. USA
74:3171-3175 |
| 5. |
Bischoff, J. R.,
D. H. Kirn,
A. Williams,
C. Heise,
S. Horn,
M. Muna,
L. Ng,
J. A. Nye,
A. Sampson-Johannes,
A. Fattaey, and F. McCormick.
1996.
An adenovirus mutant that replicates selectively in p53-deficient human tumor cells.
Science
274:373-376 |
| 6. |
Bray, M. S.,
S. Prasad,
J. W. Dubay,
E. Hunter,
K. T. Jeang,
D. Rekosh, and M. L. Hammarskjold.
1994.
A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent.
Proc. Natl. Acad. Sci. USA
91:1256-1260 |
| 7. | Dobbelstein, M., A. K. Arthur, S. Dehde, K. van Zee, A. Dickmanns, and E. Fanning. 1992. Intracistronic complementation reveals a new function of SV40 T antigen that co-operates with Rb and p53 binding to stimulate DNA synthesis in quiescent cells. Oncogene 7:837-847[Medline]. |
| 8. | Dobbelstein, M., J. Roth, W. T. Kimberly, A. J. Levine, and T. Shenk. 1997. Nuclear export of the E1B 55-kDa and E4 34-kDa adenoviral oncoproteins mediated by a rev-like signal sequence. EMBO J. 16:4276-4284[CrossRef][Medline]. |
| 9. | Fischer, U., J. Huber, W. C. Boelens, I. W. Mattaj, and R. Lührmann. 1995. The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs. Cell 82:475-483[CrossRef][Medline]. |
| 10. | Fischer, U., S. Meyer, M. Teufel, C. Heckel, R. Lührmann, and G. Rautmann. 1994. Evidence that HIV-1 Rev directly promotes the nuclear export of unspliced RNA. EMBO J. 13:4105-4112[Medline]. |
| 11. | Fornerod, M., M. Ohno, M. Yoshida, and I. W. Mattaj. 1997. CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 90:1051-1060[CrossRef][Medline]. |
| 12. |
Freedman, D. A., and A. J. Levine.
1998.
Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6.
Mol. Cell. Biol.
18:7288-7293 |
| 13. | Fukuda, M., S. Asano, T. Nakamura, M. Adachi, M. Yoshida, M. Yanagida, and E. Nishida. 1997. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 390:308-311[CrossRef][Medline]. |
| 14. |
Gabler, S.,
H. Schutt,
P. Groitl,
H. Wolf,
T. Shenk, and T. Dobner.
1998.
E1B 55-kilodalton-associated protein: a cellular protein with RNA-binding activity implicated in nucleocytoplasmic transport of adenovirus and cellular mRNAs.
J. Virol.
72:7960-7971 |
| 15. | Goodrum, F. D., and D. A. Ornelles. 1997. The early region 1B 55-kilodalton oncoprotein of adenovirus relieves growth restrictions imposed on viral replication by the cell cycle. J. Virol. 71:548-561[Abstract]. |
| 16. |
Goodrum, F. D., and D. A. Ornelles.
1998.
p53 status does not determine outcome of E1B 55-kilodalton mutant adenovirus lytic infection.
J. Virol.
72:9479-9490 |
| 17. | Goodrum, F. D., T. Shenk, and D. A. Ornelles. 1996. Adenovirus early region 4 34-kilodalton protein directs the nuclear localization of the early region 1B 55-kilodalton protein in primate cells. J. Virol. 70:6323-6335[Abstract]. |
| 18. |
Halbert, D. N.,
J. R. Cutt, and T. Shenk.
1985.
Adenovirus early region 4 encodes functions required for efficient DNA replication, late gene expression, and host cell shutoff.
J. Virol.
56:250-257 |
| 19. | Hall, A. R., B. R. Dix, S. J. O'Carroll, and A. W. Braithwaite. 1998. p53-dependent cell death/apoptosis is required for a productive adenovirus infection. Nat. Med. 4:1068-1072[CrossRef][Medline]. |
| 20. | Hay, J. G., N. Shapiro, H. Sauthoff, S. Heitner, W. Phupakdi, and W. N. Rom. 1999. Targeting the replication of adenoviral gene therapy vectors to lung cancer cells: the importance of the adenoviral E1b-55kD gene. Hum. Gene Ther. 10:579-590[CrossRef][Medline]. |
| 21. | Heise, C., A. Sampson-Johannes, A. Williams, F. McCormick, D. D. Von Hoff, and D. H. Kirn. 1997. ONYX-015, an E1B gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral efficacy that can be augmented by standard chemotherapeutic agents. Nat. Med. 3:639-645[CrossRef][Medline]. |
| 22. |
Horridge, J. J., and K. N. Leppard.
1998.
RNA-binding activity of the E1B 55-kilodalton protein from human adenovirus type 5.
J. Virol.
72:9374-9379 |
| 23. |
Huang, J., and T. J. Liang.
1993.
A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products.
Mol. Cell. Biol.
13:7476-7486 |
| 24. |
Huang, M. M., and P. Hearing.
1989.
Adenovirus early region 4 encodes two gene products with redundant effects in lytic infection.
J. Virol.
63:2605-2615 |
| 25. |
Huang, W., and S. J. Flint.
1998.
The tripartite leader sequence of subgroup C adenovirus major late mRNAs can increase the efficiency of mRNA export.
J. Virol.
72:225-235 |
| 26. | Huang, Y., K. M. Wimler, and G. G. Carmichael. 1999. Intronless mRNA transport elements may affect multiple steps of pre-mRNA processing. EMBO J. 18:1642-1652[CrossRef][Medline]. |
| 27. | Huang, Z.-M., and T. S. B. Yen. 1995. Role of the hepatitis B virus posttranscriptional regulatory element in export of intronless transcripts. Mol. Cell. Biol. 15:3864-3869[Abstract]. |
| 28. | Iacampo, S., and A. Cochrane. 1996. Human immunodeficiency virus type 1 Rev function requires continued synthesis of its target mRNA. J. Virol. 70:8332-8339[Abstract]. |
| 29. | Katahira, J., T. Ishizaki, H. Sakai, A. Adachi, K. Yamamoto, and H. Shida. 1995. Effects of translation initiation factor eIF-5A on the functioning of human T-cell leukemia virus type I Rex and human immunodeficiency virus Rev inhibited trans dominantly by a Rex mutant deficient in RNA binding. J. Virol. 69:3125-3133[Abstract]. |
| 30. |
Ketner, G.,
E. Bridge,
A. Virtanen,
C. Hemström, and U. Pettersson.
1989.
Complementation of adenovirus E4 mutants by transient expression of E4 cDNA and deletion plasmids.
Nucleic Acids Res.
17:3037-3048 |
| 31. | Kirn, D., T. Hermiston, and F. McCormick. 1998. ONYX-015: clinical data are encouraging. Nat. Med. 4:1341-1342[CrossRef][Medline]. |
| 32. | Kiyokawa, T., T. Umemoto, Y. Watanabe, S. Matsushita, and H. Shida. 1997. Two distinct pathways for intronless mRNA expression: one related, the other unrelated to human immunodeficiency virus Rev and human T cell leukemia virus type I Rex functions. Biol. Signals 6:134-142[Medline]. |
| 33. |
König, C.,
J. Roth, and M. Dobbelstein.
1999.
Adenovirus type 5 E4orf3 protein relieves p53 inhibition by E1B 55-kilodalton protein.
J. Virol.
73:2253-2262 |
| 34. | Leppard, K. N., and R. D. Everett. 1999. The adenovirus type 5 E1b 55K and E4 Orf3 proteins associate in infected cells and affect ND10 components. J. Gen. Virol. 80:997-1008[Abstract]. |
| 35. | Leppard, K. N., and T. Shenk. 1989. The adenovirus E1B 55 kd protein influences mRNA transport via an intranuclear effect on RNA metabolism. EMBO J. 8:2329-2336[Medline]. |
| 36. |
Liang, S.,
M. Hitomi, and A. M. Tartakoff.
1995.
Adenoviral E1B-55kDa protein inhibits yeast mRNA export and perturbs nuclear structure.
Proc. Natl. Acad. Sci. USA
92:7372-7375 |
| 37. | Malim, M. H., J. Hauber, S. Y. Le, J. V. Maizel, and B. R. Cullen. 1989. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338:254-257[CrossRef][Medline]. |
| 38. | Medghalchi, S., R. Padmanabhan, and G. Ketner. 1997. Early region 4 modulates adenovirus DNA replication by two genetically separable mechanisms. Virology 236:8-17[CrossRef][Medline]. |
| 39. | Mühlemann, O., J. P. Kreivi, and G. Akusjärvi. 1995. Enhanced splicing of nonconsensus 3' splice sites late during adenovirus infection. J. Virol. 69:7324-7327[Abstract]. |
| 40. |
Nishi, K.,
M. Yoshida,
D. Fujiwara,
M. Nishikawa,
S. Horinouchi, and T. Beppu.
1994.
Leptomycin B targets a regulatory cascade of crm1, a fission yeast nuclear protein, involved in control of higher order chromosome structure and gene expression.
J. Biol. Chem.
269:6320-6324 |
| 41. |
Nordqvist, K.,
K. Ohman, and G. Akusjarvi.
1994.
Human adenovirus encodes two proteins which have opposite effects on accumulation of alternatively spliced mRNAs.
Mol. Cell. Biol.
14:437-445 |
| 42. | Öhman, K., K. Nordqvist, and G. Akusjärvi. 1993. Two adenovirus proteins with redundant activities in virus growth facilitates tripartite leader mRNA accumulation. Virology 194:50-58[CrossRef][Medline]. |
| 43. | O'Neill, R. E., J. Talon, and P. Palese. 1998. The influenza virus NEP (NS2 protein) mediates the nuclear export of viral ribonucleoproteins. EMBO J. 17:288-296[CrossRef][Medline]. |
| 44. |
Orlando, J. S., and D. A. Ornelles.
1999.
An arginine-faced amphipathic alpha helix is required for adenovirus type 5 e4orf6 protein function.
J. Virol.
73:4600-4610 |
| 45. |
Ornelles, D. A., and T. Shenk.
1991.
Localization of the adenovirus early region 1B 55-kilodalton protein during lytic infection: association with nuclear viral inclusions requires the early region 4 34-kilodalton protein.
J. Virol.
65:424-429 |
| 46. |
Pilder, S.,
M. Moore,
J. Logan, and T. Shenk.
1986.
The adenovirus E1B-55K transforming polypeptide modulates transport or cytoplasmic stabilization of viral and host cell mRNAs.
Mol. Cell. Biol.
6:470-476 |
| 47. | Querido, E., R. C. Marcellus, A. Lai, R. Charbonneau, J. G. Teodoro, G. Ketner, and P. E. Branton. 1997. Regulation of p53 levels by the E1B 55-kilodalton protein and E4orf6 in adenovirus-infected cells. J. Virol. 71:3788-3798[Abstract]. |
| 48. | Rost, B., and C. Sander. 1993. Prediction of protein structure at better than 70% accuracy. J. Mol. Biol. 232:584-599[CrossRef][Medline]. |
| 49. |
Roth, J., and M. Dobbelstein.
1997.
Export of hepatitis B virus RNA on a Rev-like pathway: inhibition by the regenerating liver inhibitory factor I B .
J. Virol.
71:8933-8939[Abstract].
|
| 50. | Roth, J., M. Dobbelstein, D. A. Freedman, T. Shenk, and A. J. Levine. 1998. Nucleo-cytoplasmic shuttling of the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the human immunodeficiency virus rev protein. EMBO J. 17:554-564[CrossRef][Medline]. |
| 51. |
Roth, J.,
C. König,
S. Wienzek,
S. Weigel,
S. Ristea, and M. Dobbelstein.
1998.
Inactivation of p53 but not p73 by adenovirus type 5 E1B 55-kilodalton and E4 34-kilodalton oncoproteins.
J. Virol.
72:8510-8516 |
| 52. |
Rothmann, T.,
A. Hengstermann,
N. J. Whitaker,
M. Scheffner, and H. zur Hausen.
1998.
Replication of ONYX-015, a potential anticancer adenovirus, is independent of p53 status in tumor cells.
J. Virol.
72:9470-9478 |
| 53. | Rubenwolf, S., H. Schütt, M. Nevels, H. Wolf, and T. Dobner. 1997. Structural analysis of the adenovirus type 5 E1B 55-kilodalton-E4orf6 protein complex. J. Virol. 71:1115-1123[Abstract]. |
| 54. |
Sarnow, P.,
P. Hearing,
C. W. Anderson,
D. N. Halbert,
T. Shenk, and A. J. Levine.
1984.
Adenovirus early region 1B 58,000-dalton tumor antigen is physically associated with an early region 4 25,000-dalton protein in productively infected cells.
J. Virol.
49:692-700 |
| 55. | Sarnow, P., C. A. Sullivan, and A. J. Levine. 1982. A monoclonal antibody detecting the adenovirus type 5-E1b-58Kd tumor antigen: characterization of the E1b-58Kd tumor antigen in adenovirus-infected and -transformed cells. Virology 120:510-517[CrossRef][Medline]. |
| 56. | Shenk, T. 1996. Adenoviridae: the viruses and their replication, p. 2111-2148. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven, Philadelphia, Pa. |
| 57. | Steegenga, W. T., N. Riteco, A. G. Jochemsen, F. J. Fallaux, and J. L. Bos. 1998. The large E1B protein together with the E4orf6 protein target p53 for active degradation in adenovirus infected cells. Oncogene 16:349-357[CrossRef][Medline]. |
| 58. |
Tao, W., and A. J. Levine.
1999.
Nucleocytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degradation of p53.
Proc. Natl. Acad. Sci. USA.
96:3077-3080 |
| 59. |
Turnell, A. S.,
R. J. Grand, and P. H. Gallimore.
1999.
The replicative capacities of large E1B-null group A and group C adenoviruses are independent of host cell p53 status.
J. Virol.
73:2074-2083 |
| 60. |
Weiden, M. D., and H. S. Ginsberg.
1994.
Deletion of the E4 region of the genome produces adenovirus DNA concatemers.
Proc. Natl. Acad. Sci. USA.
91:153-157 |
| 61. | Wolff, B., J. J. Sanglier, and Y. Wang. 1997. Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem. Biol. 4:139-147[CrossRef][Medline]. |
| 62. | Yang, U. C., W. Huang, and S. J. Flint. 1996. mRNA export correlates with activation of transcription in human subgroup C adenovirus-infected cells. J. Virol. 70:4071-4080[Abstract]. |
| 63. | Yew, P. R., and A. J. Berk. 1992. Inhibition of p53 transactivation required for transformation by adenovirus early 1B protein. Nature 357:82-85[CrossRef][Medline]. |
| 64. | Zantema, A., J. A. Fransen, A. Davis-Olivier, F. C. Ramaekers, G. P. Vooijs, B. DeLeys, and A. J. van der Eb. 1985. Localization of the E1B proteins of adenovirus 5 in transformed cells, as revealed by interaction with monoclonal antibodies. Virology 142:44-58[CrossRef][Medline]. |
| 65. |
Zantema, A.,
P. I. Schrier,
A. Davis-Olivier,
T. van Laar,
R. T. Vaessen, and A. van der Eb.
1985.
Adenovirus serotype determines association and localization of the large E1B tumor antigen with cellular tumor antigen p53 in transformed cells.
Mol. Cell. Biol.
5:3084-3091 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»