Previous Article | Next Article 
Journal of Virology, September 2000, p. 7903-7910, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Role of Viral Persistence in Retaining
CD8+ T Cells within the Central Nervous
System
Norman W.
Marten,1
Stephen A.
Stohlman,1,2 and
Cornelia C.
Bergmann1,2,*
Departments of
Neurology1 and Molecular Microbiology
and Immunology,2 Keck School of Medicine,
University of Southern California, Los Angeles, California 90033
Received 6 April 2000/Accepted 8 June 2000
 |
ABSTRACT |
The continued presence of virus-specific CD8+ T cells
within the central nervous system (CNS) following resolution of acute viral encephalomyelitis implicates organ-specific retention. The role
of viral persistence in locally maintaining T cells was investigated by
infecting mice with either a demyelinating, paralytic (V-1) or
nonpathogenic (V-2) variant of a neurotropic mouse hepatitis virus,
which differ in the ability to persist within the CNS. Class I tetramer
technology revealed more infiltrating virus-specific CD8+ T
cells during acute V-1 compared to V-2 infection. However, both total
and virus-specific CD8+ T cells accumulated at similar peak
levels in spinal cords by day 10 postinfection (p.i.). Decreasing viral
RNA levels in both brains and spinal cords following initial virus
clearance coincided with an overall progressive loss of both total and
virus-specific CD8+ T cells. By 9 weeks p.i., T cells had
largely disappeared from brains of both infected groups, consistent
with the decline of viral RNA. T cells also completely disappeared from
V-2-infected spinal cords coincident with the absence of viral RNA. By
contrast, a significant number of CD8+ T cells which
contained detectable viral RNA were recovered from spinal cords of
V-1-infected mice. The data indicate that residual virus from a primary
CNS infection is a vital component in mediating local retention of both
CD8+ and CD4+ T cells and that once minimal
thresholds of stimuli are lost, T cells within the CNS cannot survive
in an autonomous fashion.
 |
INTRODUCTION |
CD8+ T cells are primary
effector cells capable of controlling many intracellular pathogens.
Acute infections can trigger potent antigen (Ag)-driven expansion and
differentiation of CD8+ T cells into cytotoxic T cells
(CTL), resulting in substantial populations of virus-specific
CD8+ T cells (1, 13, 23). During infections
localized to specific tissues, Ag-specific T cells predominate at the
site of virus replication to exert effector function (5,
13). Although the majority of activated, Ag-experienced T cells
undergo apoptosis concomitant with clearance of the infectious agent
(6, 27), a variable portion survive to become long-lived
memory T cells (1). These regulatory mechanisms serve to
minimize tissue damage and maintain homeostasis. Following viral
clearance, memory cells are generally not retained at the original site
of infection but redistribute into secondary lymphoid organs and blood
(8, 13). However, accumulation of Ag-experienced
CD8+ T cells at a preferred site has been observed
following mucosal immunization and subsequent challenge (14)
and following infection of the central nervous system (CNS) (5,
16, 20, 21). These data suggest that CD8+ T-cell
homing and retention may be dependent on the anatomical site of initial
virus entry and replication (14). It is not clear whether
accumulation or retention of CD8+ T cells at the site of
previous infection is dependent on residual Ag, expression of adhesion
molecules, soluble mediators specific for the local microenvironment,
and/or the inability to recirculate due to local barriers. In
particular, little is known about the fate of CD8+ T cells
following resolution of acute infections associated with restricted
access to immune cells, such as the CNS parenchyma.
Retention of reactivated CD8+ memory T cells within the CNS
has been demonstrated in immune mice challenged with a neurotropic influenza virus (16). The inability to detect persisting Ag or viral genome and lack of T-cell proliferation suggested that the CNS
can harbor functional CD8+ T cells for a prolonged period
in the absence of cognate Ag (16). Similarly,
CD8+ T cells were also recovered from the CNS following
clearance of the neurotropic JHM strain of mouse hepatitis virus (JHMV) (5, 20, 21). In contrast to influenza virus-specific T cells, JHMV-specific CD8+ T cells were associated
with persisting virus, as demonstrated by the presence of viral
RNA (vRNA) and rapidly lost cytolytic activity. These observations
suggested that the CNS may provide a unique environment for the
maintenance of CD8+ T cells irrespective of persisting Ag.
However, both of these infectious models differ not only in the
association with persisting vRNA but also in the CNS cell types
infected and the activation of naive versus memory CD8+
T-cell subsets. Therefore, the mechanisms involved in the continued presence of CD8+ T cells within the CNS, as well as
regulation of activational status following infection and their role in
CNS pathology, require further elucidation.
This study takes advantage of two monoclonal antibody (MAb)-selected
JHMV variants to investigate the role of persisting Ag in maintaining
the presence of CD8+ T cells within the CNS following
clearance of infectious virus. JHMV variants 2.2-V-1 and 2.2/7.2-V-2
(9, 10), designated V-1 and V-2, have similar growth
characteristics in infected mice but vastly different disease outcomes
(10, 21). Mice infected with V-1 develop a nonfatal
encephalomyelitis associated with transient paralysis and extensive
demyelination. Both the pathology and cellular immune components of V-1
infection have been characterized extensively (9, 21). By
contrast, encephalomyelitis induced by infection with the closely
related V-2 variant is essentially asymptomatic and is characterized by
little or no demyelination (10, 21). Despite these vastly
different disease outcomes, infectious virus is cleared from the CNS
with similar kinetics (11, 21). During acute JHMV infection,
CD8+ T cells are the primary immune effectors responsible
for eliminating infectious virus (29). Following infection
with V-1 or V-2, virus-specific CD8+ T cells constitute up
to 50% of the infiltrating CD8+ mononuclear cell
population (5, 21). Furthermore, large numbers of
virus-specific CD8+ T cells are found within the CNS for
several weeks following clearance of both infectious viruses (5,
21). Nevertheless, V-1-infected mice fail to achieve sterile
immunity, resulting in a persistent infection as evidenced by the
detection of life-long persisting vRNA (4, 12). Persistence
is primarily localized to the spinal cord white matter and is
associated with ongoing focal demyelination and chronic mononuclear
cell infiltration, hallmarks reminiscent of the human disease multiple
sclerosis. By contrast, histological evidence suggests that V-2 only
transiently infects cells of the spinal cord (21). These
distinct infections were therefore used as experimental models to
examine the correlation between persisting virus and maintenance of
virus-specific CD8+ T cells within the CNS.
Analysis of brains and spinal cords revealed that T-cell infiltration
closely reflected the distribution and level of vRNA characteristic for
either infection. During both infections, T-cell recruitment was
maximal between days 7 and 10 postinfection (p.i.), with delayed
infiltration of virus-specific CD8+ T cells into the spinal
cord compared to the brain. However, recovery of T cells 2 months after
clearance of infectious virus was clearly dependent on the presence of
detectable vRNA, independent of T-cell specificity. The data suggest
that survival and/or continued recruitment of both virus-specific and
heterologous CD8+ T cells as well as CD4+ T
cells in CNS tissue following control of a primary viral infection is
mediated by the presence of persisting virus.
 |
MATERIALS AND METHODS |
Mice and viruses.
Male BALB/c (H-2d)
mice were purchased from the National Cancer Institute (Frederick, Md.)
at 6 weeks of age and certified naive to prior mouse hepatitis virus
exposure. Mice were housed in an accredited animal facility at the
University of Southern California and infected within 1 week of
arrival. CNS infections were induced by intracranial injection of 30 µl containing 1,000 PFU of JHMV MAb-selected variants V-1 and V-2
(9, 10). Viruses were propagated and quantitated by plaque
assay using the murine DBT astrocytoma cell line as described elsewhere
(28).
Determination of vRNA by RT-PCR.
Mice were sacrificed by
CO2 asphyxiation, and individual brains and spinal cords
were taken separately after severing the junction between the brain
stem and spinal cord. RNA was extracted from one-quarter brain or
one-half spinal cord as described previously (4). Briefly,
samples were lysed in guanidinium thiocyanate using a Ten Broeck
homogenizer, passed through a 25-gauge needle, and then centrifuged
over 5.4 M CsCl at 105 × g for 16 h
at ambient temperature. cDNA was synthesized by mixing 2 µg of RNA
with random hexanucleotide primers and avian myeloblastosis reverse
transcriptase (RT; Promega, Madison, Wis.) and incubated for 1 h
at 42°C. Nested PCR primers for amplification of viral nucleocapsid
(N) gene nucleotides 534 to 898 (GTCGCAAGCCAACAGGCCG and
GGAGTCCTCTTTTGACGAGGC) and 548 to 858 (CCATGGCCGAGACTAGGACCTCT and
CTGCCTGACTTCTTTGGCACT) as well as for host hypoxanthine
phosphoriboxyltransferase (HPRT) cDNA (25) were purchased
from Genosys Biotechnologies (The Woodlands, Tex.). PCR amplification
conditions consisted of 5 min at 95°C followed by 30 cycles for HPRT,
35 cycles for the external N primer set, and 20 cycles for the internal
N primer set at 95°C for 1 min, 58°C for 1 min, and 72°C for 2 min.
Isolation of CNS-derived CD8+ T cells and IFN-
ELISPOT assays.
Mononuclear cells were derived from the CNS of
mice as described previously (5, 21). Briefly, brains or
spinal cords were pooled from groups of six to eight mice and
homogenized in RPMI 1640 supplemented with 25 mM HEPES and 1% fetal
bovine serum using Ten Broeck tissue homogenizers. Cells were suspended
in 30% Percoll, concentrated onto a 1-ml cushion of 70% Percoll by centrifugation at 800 × g for 20 min at 4°C, and
collected from the interphase. Typical yields of mononuclear cells
ranged from ~5 × 105 to ~1.5 × 106 per brain and ~8 × 104 to ~2 × 105 per spinal cord, with the lower range of cells being
recovered during latter stages of infection. To control for
contamination with blood-borne mononuclear cells, mice were perfused
with 30 ml of phosphate-buffered saline prior to tissue isolation where indicated. Enzyme-linked immunospot (ELISPOT) assays to measure the
frequency of Ag-specific gamma interferon (IFN-
)-secreting cells
among splenocytes were carried out as described previously (20). Spots from two mononuclear cell dilutions
(n = 6) were counted.
Fluorescence-activated cell sorting analysis.
Expression of
cell surface markers was determined by staining cells with MAbs
specific for CD8 (53.67) and CD4 (GK1.5) as described elsewhere
(5). All MAbs were purchased from PharMingen (San Diego,
Calif.). The Ld major histocompatibility complex (MHC)
class I tetramer associated with pN318-326 peptide (Ld-pN)
has been described elsewhere (5).
 |
RESULTS |
JHMV variant V-1 persistently infects the spinal cord, whereas V-2
is cleared.
Chronic demyelination in V-1-infected mice is
associated with persisting vRNA, which can be detected for up to 2 years p.i. (4, 12). Although V-2 infection is clinically
asymptomatic, the ability of V-2 to persist is unknown. To assess the
relative abilities of V-1 and V-2 to persist in infected BALB/c mice
(H-2d), CNS tissues were examined for the
presence of viral N RNA as well as the housekeeping gene HPRT by RT-PCR
at multiple intervals p.i. Brain RNA and spinal cord RNA were analyzed
separately due to the more rapid and extensive virus spread to the
spinal cord during V-1 compared to V-2 infection (21).
Similar levels of V-1 and V-2 RNA were observed in brains during acute
infection at days 7 and 11 p.i. (Fig. 1A and
B). vRNA in brains declined sharply by
day 33 p.i. and was undetectable by day 63 p.i. following infection with both viruses. Relative to naive mice, HPRT products exhibited similar levels of intensity at all time points, confirming the specific decline in vRNA after day 11 p.i. (Fig. 1A and B), coincident with clearance of infectious virus (21). To
detect low levels of persisting vRNA, RNA isolated on days 33 and
63 p.i. was analyzed following two rounds of amplification using a
nested set of viral N-gene-specific primers. Following the second amplification, vRNA was readily detected in brain samples from all
infected mice at day 33 p.i. (Fig. 1C). At day 63 p.i. vRNA was still detected in two of four V-1-infected mice but was below detection levels in all V-2-infected mice. These data indicate that
vRNA was cleared to a variable extent from the brains of V-1-infected
mice. By contrast, V-2 RNA was completely cleared from the brains of
V-2-infected mice within 8 to 9 weeks p.i.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
Presence of vRNA in brains of V-1- and V-2-infected
mice. Total RNA was prepared from brains of four individual mice
infected with either V-1 (A) or V-2 (B) at days 7, 11, 33, and 63 p.i. as indicated. Sequences from the viral N RNA and host HPRT RNA (A
and B) were amplified and analyzed by gel electrophoresis. PCR products
from days 33 and 63 p.i. were further amplified using a nested set
of primers for the viral N gene (C). M, marker; N, naive control mouse;
, no RNA used during the cDNA synthesis.
|
|
Although V-1 and V-2 initially replicate in the brain, V-1 Ag and RNA
are most abundant in the spinal cords in persistently
infected mice
(
4,
12,
21). To verify complete clearance
of V-2 RNA from
the CNS while confirming the ability of V-1 to
establish persistence
within the spinal cord, the presence of
vRNA in spinal cords from
infected and naive mice was tested (Fig.
2). Following a single round of
amplification, V-1 RNA was readily
detectable in all mice to day
11 p.i. and in two of four mice
at day 33 p.i. (Fig.
2A). By
contrast, V-2 RNA levels were lower
and no longer detected at day
33 p.i. (Fig.
2B). Following reamplification
using the nested N
primer set, vRNA was detected in spinal cords
from all V-1-infected
mice at days 33 and 63 p.i. (Fig.
2C). By
contrast, vRNA was
detected in only three out of four V-2-infected
mice at day 33 p.i. and was undetectable by day 63 p.i. (Fig.
2C). These data
provided crucial information for subsequent analysis
of T-cell
retention within the CNS: (i) V-1 established a chronic
CNS infection
in BALB/c mice, whereas V-2 was effectively cleared;
(ii) the spinal
cord was confirmed as the preferential site of
chronic V-1 infection;
and (iii) vRNA was transiently found in
the spinal cords of V-2
infected mice, albeit at lower levels
than in V-1 infected mice.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Presence of vRNA in spinal cords of V-1- and
V-2-infected mice. Total RNA was prepared from spinal cords of four
individual mice infected with either V-1 (A) or V-2 (B) at each of the
indicated time points. Sequences from the viral N RNA and host HPRT RNA
(A and B) were amplified and analyzed by gel electrophoresis. PCR
products from days 33 and 63 p.i. were further amplified using a
nested set of primers for the viral N gene (C). M, marker; N, naive
control mouse; , no RNA used during the cDNA synthesis.
|
|
Clearance of vRNA coincides with disappearance of CD8+
T cells from the CNS.
Infection of the CNS by both V-1 and V-2 in
BALB/c mice induces vigorous local CD8+ T-cell responses
specific for the dominant N protein epitope (20, 21).
Furthermore, these CD8+ T cells are present in the CNS for
at least 1 month following clearance of infectious virus (5,
21). To determine whether persisting virus plays a role in
maintaining T cells within the CNS, mice infected with either V-1 or
V-2 were analyzed for CNS mononuclear cell infiltration during and
after acute infection. As comparisons of CNS tissue from perfused and
nonperfused mice revealed no differences in either the relative
percentage or absolute numbers of CNS infiltrating T-cell subsets (data
not shown), all data were derived from nonperfused mice. Brains and
spinal cords were examined separately, as vRNA is sequestered
differentially between these tissues at different times p.i. Due to the
low number of cells recovered during the latter stages of infection,
especially within the spinal cord (~8 × 104 cells
per mouse), CNS mononuclear cells pooled from six to eight mice were
analyzed per time point. Brain-derived mononuclear cells were stained
with anti-CD8 MAb and the Ld-pN tetramer specific for the
immunodominant N epitope recognized in H-2d mice
and analyzed by flow cytometry. Representative gates set for live
mononuclear cells from each time point are shown in Fig. 3A. During the peak of T-cell
infiltration (day 7 p.i.), the frequency of total CD8+
T cells (41.5% versus 34.9%) as well as of tetramer+
CD8+ T cells (17.2% versus 12.4%) was higher in brains of
V-1-infected mice compared to V-2-infected mice (Fig. 3B), confirming a
superior response induced by V-1 infection (21). By day
33 p.i., CD8+ T-cell percentages had decreased;
however, the proportion of tetramer+ cells within the brain
remained fairly constant, although total CD8+ T cells and
tetramer+ CD8+ T cells were slightly higher in
V-2-infected mice (Fig. 3B). By day 70 p.i., when vRNA was
undetectable in the brains of all V-2-infected and 50% of V-1-infected
mice (Fig. 1C), levels of CD8+ T cells induced by both
infections were significantly reduced (Fig. 3B). A slightly higher
percentage of brain CD8+ T cells in V-1-infected mice
compared to V-2-infected mice (1.2% versus 0.4%) may result from low
levels of vRNA in some animals. However, the frequency of
CD8+ T cells isolated from brains of infected mice at day
70 p.i. approximate those found within the brains of naive animals
(data not shown).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 3.
Presence of virus-specific CD8+ T cells in
the brain. Brain mononuclear cells were isolated from six to eight mice
sacrificed at days 7, 10, 33, and 70 p.i. as indicated and pooled
prior to analysis. Live mononuclear cells were gated based on forward
and side scatter (FSC and SSC) analysis, and representative gates are
shown for each time point (A). Brain mononuclear cells were stained
directly ex vivo with MAb to CD8 and the Ld-pN tetramer
reagent (B). Numbers in the right quadrants represent percentages of
tetramer+ CD8+ T cells (upper number) and
tetramer CD8+ T cells (lower number). The
data presented in panel B were used to calculate the total number of
infiltrating CD8+ T cells (C) and total number of
tetramer+ CD8+ T cells (D) per brain.
|
|
To compensate for higher yields of mononuclear cells during acute
infection, absolute numbers of total CD8
+ T cells and
tetramer
+ CD8
+ T cells recovered from the brain
were determined (Fig.
3C and
D, respectively). Infiltration by total
CD8
+ T cells and tetramer
+ CD8
+ T
cells peaked at day 7 p.i., with slightly greater numbers in
V-1-infected animals. By day 33 p.i., both total CD8
+
and tetramer
+ CD8
+ T-cell numbers declined more
than fivefold in V-1-infected animals,
but only about threefold in
V-2-infected animals. By day 70 p.i.,
however, CD8
+ T
cells were reduced approximately 30-fold in V-1-infected animals
and
approximately 55-fold in V-2-infected animals compared to
the
respective peak levels of infiltration at day 7 p.i. These
data
suggest that the vast majority of CD8
+ T cells are
ultimately cleared from the brains of JHMV-infected
animals when vRNA
levels are near or below detection
thresholds.
All infections were initiated by intraparenchymal injection; however,
V-1 spreads down the ependymal cells lining the central
canal of the
spinal cord and migrates centripetally through the
surrounding gray
matter of the cord, where it establishes persistent
infection of the
spinal cord white matter (
32). By contrast,
V-2 is more
limited in its ability to infect the spinal cord (
21).
Consistent with the distribution of Ag, flow cytometric analysis
of
mononuclear cells from spinal cords revealed a delay in peak
CD8
+ T-cell infiltration compared to the brain during both
infections
(Fig.
4A). CD8
+
T-cell infiltration in the spinal cord was maximal at day 10
p.i.,
comprising 34% for V-1-infected mice, compared to 39% of
the
mononuclear cell population for V-2 infection (Fig.
4A). Although
frequencies of tetramer
+ CD8
+ T cells were
initially lower in spinal cords of V-2-infected
mice, levels
approximated those in spinal cords of V-1-infected
mice by day 10 p.i. As found for the brain, total CD8
+ T-cell percentages
dropped significantly by day 33 p.i. Most
importantly, by day
70 p.i. CD8
+ T cells, including tetramer
+
T cells, comprised distinct populations within mononuclear cells
from
spinal cords of mice persistently infected with V-1 but were
virtually
absent in mice that had cleared V-2, as demonstrated
by the absence of
detectable vRNA (Fig.
1C).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4.
Presence of virus-specific CD8+ T cells in
the spinal cord. Mononuclear cells were isolated from the spinal cords
of V-1- and V-2-infected mice (n = 6 to 8) at the
indicated time points and pooled prior to ex vivo staining with
anti-CD8 MAb and the Ld-pN tetramer reagent (A). Numbers
shown in the right quadrants represent percentages of
tetramer+ CD8+ T cells (upper number) and
tetramer CD8+ T cells (lower number). The
data presented in panel A were used to calculate the total number of
infiltrating CD8+ T cells (B) and total number of
tetramer+ CD8+ T cells (C) per spinal cord.
|
|
Numbers of total CD8
+ T cells and tetramer
+
CD8
+ T cells recovered are presented on a per-cord basis in
Fig.
4B and C, respectively.
Although V-1 infection recruited over four
times as many total
CD8
+ T cells and tetramer
+
CD8
+ T cells as V-2 infection on day 7 p.i.,
populations peaked at
similar numbers at day 10 p.i. Consistent
with the severely reduced
vRNA levels, CD8
+ T-cell numbers
declined by day 33 p.i. By day 70 p.i., spinal
cords of
V-1-infected mice contained approximately 11,000 CD8
+ T
cells per spinal cord, compared to fewer than 200 CD8
+ T
cells per spinal cord of mice that had cleared V-2 infection.
Thus, two
lines of evidence indicate that persistent virus is
required to locally
maintain CD8
+ T cells recruited to a primary infection
within the CNS: CD8
+ T cells disappear from both the brain
and spinal cord concomitant
with clearance of vRNA from V-2-infected
mice; and CD8
+ T cells localize preferentially to regions
with more abundant
vRNA, i.e., within the spinal cord rather than the
brain during
persistent V-1
infection.
CD4+ T cells follow similar patterns of CNS retention
as CD8+ T cells.
As survival and function of
CD8+ T cells in the CNS are dependent on the presence of
CD4+ T cells (30), mice infected with either V-1
or V-2 were analyzed for the retention of CD4+ T cells
within the brain and spinal cord. Analysis of brain-derived mononuclear
cells revealed that infiltration by CD4+ T cells was
maximal at days 7 and 10 p.i., ranging from 19 to 26% of the
total mononuclear cell population (Fig.
5A). As found for CD8+ T
cells, these frequencies dropped to half (8 to 9%) by day 33 p.i.
and declined to approximately 2 to 3% by day 70 p.i. (Fig. 5A).
Furthermore, brain-derived mononuclear cells contained similar total
numbers of CD4+ T cells throughout infection with both
viruses, with the exception of day 10 p.i., when the brains of
V-2-infected mice contained a slightly increased number of
CD4+ T cells (Fig. 5B). These data demonstrate similar
kinetics of CD4+ T-cell recruitment during both infections,
followed by a decline subsequent to virus reduction and leading to
ultimate clearance in the absence of detectable vRNA.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Presence of CD4+ T cells in the brain and
spinal cord. Mononuclear cells were isolated from brains and spinal
cords of V-1- and V-2-infected mice at the indicated time points
(n = 6 to 8). For each time point, mononuclear cells
from brains were pooled as one set and mononuclear cells from spinal
cords were pooled as a separate set prior to ex vivo staining with
anti-CD4 MAb (A). The data presented in panel A were used to calculate
the average number of infiltrating CD4+ T cells on a
per-brain basis (B) as well as the average number of CD4+ T
cells per spinal cord (C).
|
|
In contrast to the brain, the frequency of CD4
+ T cells
within the spinal cord was two to six times higher in V-1-infected
mice
than in V-2-infected mice at all time points except day 10
p.i.
(Fig.
5A). These differences were more evident when total
infiltrating
CD4
+ T cells were compared on a per-cord basis (Fig.
5C).
Overall
CD4
+ T cells were maintained at a high level within
the spinal cord
throughout the course of V-1 infection. By contrast,
CD4
+ T cells infiltrated the spinal cord only transiently
during acute
V-2 infection and declined rapidly by day 33 p.i.
Thus, viral
persistence appears to mediate a prolonged presence not
only of
CD8
+ T cells but also of CD4
+ T cells
within the
CNS.
Continued presence of T cells in the CNS does not alter maintenance
or function in the periphery.
Retention of virus-specific
CD8+ T cells within the CNS during V-1 persistence may be
associated with rapid turnover of newly recruited cells, ultimately
leading to a decline of responsive memory T cells in peripheral
lymphoid tissue. To compare relative frequencies of virus-specific
CD8+ T cells in the periphery of V-1- and V-2-infected
mice, N-epitope-responsive T cells from the spleen were enumerated by
IFN-
ELISPOT (Table 1), as the
frequencies are too low for accurate determination by tetramer
staining. In contrast to observations within the CNS, acute V-2
infection was associated with higher frequencies of Ag-specific T cells
in the periphery (days 7 and 14 p.i.) compared to V-1 infection.
At later time points when T cells were no longer prevalent within the
CNS of V-2-infected animals, the frequencies of N-specific splenocytes
were comparable between V-1- and V-2-infected animals. Specifically,
V-1-infected mice contained 31 Ag-specific T cells/106
splenocytes and V-2-infected mice contained 47 Ag-specific T cells/106 splenocytes at day 63 p.i. Thus, persistent
V-1 infection did not appear to result in a significant depletion of
memory CD8+ T cells compared to transient V-2 infection.
 |
DISCUSSION |
Recent studies of T-cell regulation following acute encephalitis
induced by either neurotropic influenza virus (16) or JHMV (5, 21) demonstrate that the CNS is unique in harboring
significant numbers of Ag-specific CD8+ T cells after
clearance of infectious virus. However, the factors that promote their
survival are not well understood. Whereas the continued presence of
reactivated influenza virus-specific memory CD8+ T cells
appears to be independent of virus retention (16), JHMV-specific CD8+ T cells may be maintained by persisting
virus (4, 5). This dichotomy was addressed by concomitantly
examining the fate of vRNA as a marker of viral persistence and
CD8+ T cells in the CNS following primary infections with
two closely related neurotropic viruses. RT-PCR analysis to detect vRNA
confirmed that injection of the nondemyelinating V-2 variant results in a transient infection of the brain and spinal cord (21),
which is ultimately cleared from both tissues by day 63 p.i. By
contrast, mice infected with the demyelinating V-1 variant all had
detectable levels of vRNA in spinal cords, with variable detection in
the brain, confirming predominant persistence within the spinal cord. Enumeration of virus-specific CD8+ T cells in the CNS by
flow cytometry using class I tetramers demonstrated that
tetramer+ CD8+ T cells constituted prominent
populations in both the brains and spinal cords to day 33 p.i. in
both infected groups. Even at day 70 p.i., spinal cords from
persistently V-1-infected mice still contained a considerable frequency
of CD8+ T cells comprised of 30% N-specific cells. In
striking contrast, CD8+ T cells had dropped to background
levels in spinal cords of mice that had completely cleared V-2.
Similarly, CD8+ and CD4+ T cells had
disappeared from the brains of mice once vRNA levels dropped to
or below RT-PCR detection thresholds. These data indicated that vRNA
expression is a key factor in promoting the presence of
CD8+ T cells within the CNS following clearance of
infectious virus. Whether these cells survive locally or are
continually recruited remains to be elucidated.
Ultimate loss of CD8+ T cells from the V-2-infected CNS
could not be attributed to overall quantitative or qualitative
differences in T-cell infiltrates during acute replication.
Infiltration by both tetramer+ and total CD8+
populations was highest between days 7 and 10 p.i. and declined abruptly by day 33 p.i. in both brains and spinal cords,
coincident with significantly reduced vRNA levels. Peak T-cell
infiltration into the spinal cord was delayed compared to the brain
during both infections, reaching remarkably similar maximal levels in both V-1- and V-2-infected mice at day 10 p.i. Furthermore, lower numbers of CD8+ T cells in spinal cords of V-2-infected
mice reflected diminished detection of V-2 compared to V-1 RNA in the
cord tissue. Despite the divergent clinical symptoms and propensities
to persist, the JHMV variants induced CD8+ T-cell responses
comparable in not only magnitude but also function (21). An
underestimate of Ag-specific cells due to down-regulation of T-cell
receptor expression is unlikely, as the percentage of IFN-
-producing
CD8+ T cells determined by intracellular staining never
exceeded that of tetramer+ CD8+ T cells
throughout the course of infection (data not shown). Thus, clearance of
CD8+ T cells cannot be attributed to differential
expression of effector function or regulation of CD8+ T
cells induced to V-1 versus V-2. This was supported by continued activation of CD8+ T cells throughout the infection, as
evidenced by peak expression of the early activation marker CD69 on
90% of CD8+ T cells at day 10 p.i., and a decline
only to 80% positive cells by day 33 p.i., despite the drop in
vRNA throughout this period (data not shown). CD69 expression is a
common hallmark of CD8+ T cells retained in the CNS
following viral infection (5, 16, 21).
Two major differences between the influenza virus and the JHMV models
may account for disparate roles of persisting Ag in CD8+
T-cell survival within the CNS. Whereas CD8+ T cells found
in the CNS of mice infected with JHMV arise from a primary CNS
infection, T cells recruited during influenza virus CNS infection are
of memory origin (16). Ag-specific memory T cells are
present at a higher frequency and are less dependent on costimulation
than naive CTL precursor cells; furthermore, memory cells demonstrate
an increased ability to infiltrate extravascular tissues
(8). Reactivation of influenza virus-specific memory CD8+ T cells may thus result in substantially greater
virus-specific CD8+ T-cell infiltration during secondary
viral challenge compared to the primary JHMV response (13,
31). In addition, memory T cells infiltrating the CNS may be
maintained in a different state of activation or autonomous
proliferation compared to CD8+ T cells, which never acquire
the classical memory phenotype due to persistent infection. The second
difference is the neuronal tropism of the influenza virus versus the
predominant glial tropism of the two JHMV variants. Neurons have a
highly limited capacity for class I presentation (17, 22).
By contrast, glial cells, primarily microglia and to a lesser degree
astrocytes, present both class I- and class II-restricted Ag, thus
potentially providing a superior activation stimulus (2, 3, 15,
17, 22, 26, 33). Furthermore, expression of costimulatory
molecules expressed by activated microglia may contribute to enhanced
T-cell receptor activation when MHC presentation is low (2, 3, 26).
Disappearance of T cells from both brains and spinal cords following
the decline of vRNA supports the notion that persisting virus provides
a signal for maintaining the presence of T cell within the CNS.
However, it is unclear whether chronic activation occurs directly via
T-cell receptor recognition or indirectly by ongoing pathogenic
processes. Plausible mechanisms for continued MHC presentation may
reside in low-level viral Ag expression and class I processing, low
class I turnover on resident CNS cells, and/or cross-priming of
exogenous viral protein products. The inability to detect intact viral
Ag by histochemistry after 35 days p.i. (reference 21 and data not
shown) suggests that proof of direct class I presentation will be
experimentally challenging. Furthermore, the tight link between
persisting vRNA and chronic demyelination in V-1-infected mice makes it
difficult to assess relative cause and effects of persisting T cells.
In contrast to V-2 infection, V-1 induces expansive demyelination by
day 14 p.i.; as demyelination is associated with both astrocyte
and macrophage/microglia activation, this process may recruit or
maintain CD8+ T cells via cytokine or chemokine secretion
(2, 18). If demyelination, rather than Ag presentation, were
a major factor in maintaining the presence of CD8+ T cells,
spinal cords from V-1-infected mice would be expected to contain
considerably more CD8+ T cells at day 33 p.i., when
RNA levels are already low. However, despite clearance of infectious
virus by day 15 p.i. (21), both infections are
associated not only with a persisting presence of CD8+ T
cells in the brain and spinal cords to day 33 p.i. but also with
similar absolute levels. These data do not support the notion that the
demyelinating process itself enhances the presence of CD8+
T cells within the CNS. The CNS thus appears to differ from other nonlymphoid tissue in delaying the exit or death of T cells after the
vast majority of Ag is cleared.
The specificities of tetramer
CD8+ T cells
found in the CNS throughout both infections are still elusive. The
ratio of tetramer+ to tetramer
populations
remained fairly similar throughout the courses of both infections,
suggesting early recruitment of bystander cells or cells responding to
some as yet undefined viral epitope(s). Interestingly, after vRNA
levels dropped below the level of detection, disappearance of T cells
was not limited to the tetramer+ CD8+ T cells
but was found for all CD8+ and CD4+ T cells.
These data indicate that the tetramer
CD8+ T
cells are not specific for a CNS-derived Ag. Although it cannot be
excluded that the tetramer
CD8+ T cells
during V-1 and V-2 infections comprise distinct populations with
heterologous specificities, disappearance of these cells, concomitant
with vRNA clearance, supports the suggestion that they are not
potential autoimmune cells.
In summary, these data demonstrate that viral persistence, as measured
by vRNA, is necessary to provide sufficient stimulus to maintain the
presence of both CD8+ and CD4+ T cells in the
CNS. The continued presence of T cells within the CNS is independent of
the magnitude of initial infiltration or propensity of the infection to
induce either acute or chronic demyelination. Thus, unlike
Ag-independent turnover of memory T cells in the periphery
(24), T cells recruited to the CNS from a naive precursor
pool are incapable of autonomous proliferation within the CNS.
Furthermore, the absence of CNS pathology following V-2 infection,
despite extensive local CD8+ T-cell infiltration and
effector function (21), followed by ultimate disappearance
of all T cells from the CNS suggests that the initial presence of
CD8+ T cells within the CNS is not sufficient to break
tolerance to host epitopes. Thus, the similarities between the immune
responses, despite vastly differing pathologies, argue against either
molecular mimicry or epitope spreading as a means of chronic
CD8+ T-cell stimulation and CNS pathology.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grants NS 18146, AI 33314, and NS 07149.
We thank Wenqiang Wei and Margaret Kornacki for exceptional technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 1333 San Pablo
St., MCH 142, Los Angeles, CA 90033. Phone: (323) 442-1062. Fax: (323) 225-2369. E-mail: cbergman{at}hsc.usc.edu.
 |
REFERENCES |
| 1.
|
Ahmed, R., and D. Gray.
1996.
Immunological memory and protective immunity: understanding their relation.
Science
272:54-59[Abstract].
|
| 2.
|
Aloisi, F.,
R. De Simone,
S. Columba-Cabezas,
G. Penna, and L. Adorini.
2000.
Functional maturation of adult mouse resting microglia into an APC is promoted by granulocyte-macrophage colony-stimulating factor and interaction with Th1 cells.
J. Immunol.
164:1705-1712[Abstract/Free Full Text].
|
| 3.
|
Aloisi, F.,
F. Rea, and L. Adorini.
2000.
Regulation of T cell response by CNS antigen-presenting cells: different roles for microglia and astrocytes.
Immunol. Today
21:141-147[CrossRef][Medline].
|
| 4.
|
Bergmann, C. C.,
E. Dimacali,
S. Stohl,
W. Wei,
M. M. C. Lai,
S. Tahara, and N. Marten.
1998.
Variability of persisting MHV RNA sequences comprising immune and replication relevant domains.
Virology
244:563-572[CrossRef][Medline].
|
| 5.
|
Bergmann, C. C.,
J. D. Altman,
D. Hinton, and S. A. Stohlman.
1999.
Inverted immunodominance and impaired cytolytic function of CD8+ T cells during viral persistence in the CNS.
J. Immunol.
163:3379-3387[Abstract/Free Full Text].
|
| 6.
|
Combadiere, B.,
C. Reis e Sousa,
C. Trageser,
L. X. Zheng,
C. R. Kim, and M. J. Lenardo.
1998.
Differential TCR signaling regulates apoptosis and immunopathology during antigen responses in vivo.
Immunity
9:305-313[CrossRef][Medline].
|
| 7.
|
Dhib-Jalbut, S. S.,
Q. Xia,
P. D. Drew, and P. T. Swoveland.
1995.
Differential up-regulation of HLA class I molecules on neuronal and glial cell lines by virus infection correlates with differential induction of IFN-beta.
J. Immunol.
155:2096-2108[Abstract].
|
| 8.
|
Doherty, P. C.,
S. Hou, and R. A. Tripp.
1994.
CD8+ T-cell memory to virus.
Curr. Opin. Immunol.
6:545-552[CrossRef][Medline].
|
| 9.
|
Fleming, J. O.,
M. Trousdale,
F. E. Zactarim,
S. A. Stohlman, and L. P. Weiner.
1986.
Pathogenicity of antigenic variants of murine coronavirus JHM selected with monoclonal antibody.
J. Virol.
58:869-875[Abstract/Free Full Text].
|
| 10.
|
Fleming, J. O.,
M. Trousdale,
S. A. Stohlman, and L. P. Weiner.
1987.
Pathogenic characteristics of neutralization-resistant variants of JHM coronavirus (MHV-4).
Adv. Exp. Med. Biol.
218:333-342[Medline].
|
| 11.
|
Fleming, J. O.,
M. D. Trousdale,
J. Bradbury,
S. A. Stohlman, and L. P. Weiner.
1987.
Experimental demyelination induced by coronavirus JHM (MHV-4): molecular identification of a viral determinant of paralytic disease.
Microb. Pathog.
3:9-20[CrossRef][Medline].
|
| 12.
|
Fleming, J. O.,
J. J. Houtman,
H. Alaca,
H. C. Hinze,
D. McKenzie,
J. Aiken,
T. Bleasdale, and S. Baker.
1994.
Persistence of viral RNA in the central nervous system of mice inoculated with MHV-4, p. 327-332.
In
H. Laude, and J. F. Vautherot (ed.), Coronaviruses 1994. Plenum Press, New York, N.Y.
|
| 13.
|
Flynn, K. J.,
G. T. Belz,
J. D. Altman,
R. Ahmed,
D. L. Woodland, and P. C. Doherty.
1998.
Virus-specific CD8+ T cells in primary and secondary influenza pneumonia.
Immunity
8:683-691[CrossRef][Medline].
|
| 14.
|
Gallichan, W. S., and K. L. Rosenthal.
1996.
Long-lived cytotoxic T lymphocyte memory in mucosal tissues after mucosal but not systemic infections.
J. Exp. Med.
184:1879-1890[Abstract/Free Full Text].
|
| 15.
|
Hart, M. N., and Z. Fabry.
1994.
CNS antigen presentation.
Trends Neurosci.
18:475-481.
|
| 16.
|
Hawke, S.,
P. G. Stevenson,
S. Freeman, and C. R. M. Bangham.
1998.
Long-term persistence of activated cytotoxic T lymphocytes after viral infection of the central nervous system.
J. Exp. Med.
187:1575-1582[Abstract/Free Full Text].
|
| 17.
|
Horwitz, M. S.,
C. F. Evans,
F. G. Klier, and M. B. Oldstone.
1999.
Detailed in vivo analysis of interferon-gamma induced major histocompatibility complex expression in the central nervous system: astrocytes fail to express major histocompatibility complex class I and II molecules.
Lab. Investig.
79:235-242[Medline].
|
| 18.
|
Lane, T. E.,
V. C. Asensio,
N. Yu,
A. D. Paoletti,
I. L. Campbell, and M. J. Buchmeier.
1998.
Dynamic regulation of alpha- and beta-chemokine expression in the central nervous system during mouse hepatitis virus-induced demyelinating disease.
J. Immunol.
160:970-978[Abstract/Free Full Text].
|
| 19.
|
Li, X. Y.,
G. Matsuzaki,
Y. Yoshikai,
K. Muramori, and K. Nomoto.
1993.
T cells expressing both L-selectin and CD44 molecules increase in number in peritoneal exudates cells and in vitro-stimulated spleen cells from mice immunized intraperitoneally with Listeria monocytogenes.
Immunology
78:28-34[Medline].
|
| 20.
|
Marten, N. W.,
S. A. Stohlman,
W. Smith-Begolka,
S. D. Miller,
E. Dimacali,
Q. Yao,
S. Stohl,
J. Goverman, and C. C. Bergmann.
1999.
Selection of CD8+ T cells with a highly focused specificity during viral persistence in the central nervous system.
J. Immunol.
162:3905-3914[Abstract/Free Full Text].
|
| 21.
|
Marten, N. W.,
S. A. Stohlman,
R. D. Atkinson,
D. R. Hinton,
J. O. Fleming, and C. C. Bergmann.
2000.
Contributions of CD8+ T cells and viral spread to demyelinating disease.
J. Immunol.
164:4080-4088[Abstract/Free Full Text].
|
| 22.
|
Massa, P. T.,
K. Ozato, and D. E. McFarlin.
1993.
Cell type-specific regulation of major histocompatibility complex (MHC) class I gene expression in astrocytes, oligodendrocytes, and neurons.
Glia
8:201-217[CrossRef][Medline].
|
| 23.
|
Murali-Krishna, K.,
J. D. Altman,
M. Suresh,
D. J. D. Sourdive,
A. J. Zajac,
J. S. Miller,
J. Slansky, and R. Ahmed.
1998.
Counting antigen-specific CD8+ T cells: a reevaluation of bystander activation during viral infection.
Immunity
8:177-187[CrossRef][Medline].
|
| 24.
|
Murali-Krishna, K.,
L. L. Lau,
S. Sambhara,
F. Lemonnier,
J. Altman, and R. Ahmed.
1999.
Persistence of memory CD8+ T cells in MHC class I-deficient mice.
Science
286:1377-1381[Abstract/Free Full Text].
|
| 25.
|
Murphy, E.,
S. Hieny,
A. Sher, and A. O'Garra.
1993.
Detection of in vivo expression of interleukin-10 using a semi-quantitative polymerase chain reaction method in Schistosoma mansoni infected mice.
J. Immunol. Methods
162:211-223[CrossRef][Medline].
|
| 26.
|
Pope, J. G.,
C. L. Vanderlugt,
S. M. Rahbe,
H. L. Lipton, and S. D. Miller.
1998.
Characterization of and functional antigen presentation by central nervous system mononuclear cells from mice infected with Theiler's murine encephalomyelitis virus.
J. Virol.
72:7762-7771[Abstract/Free Full Text].
|
| 27.
|
Salmon, M.,
D. Pilling,
N. J. Borthwick,
N. Viner,
G. Janossy,
P. A. Bacon, and A. N. Akbar.
1994.
The progressive differentiation of primed T cells is associated with an increasing susceptibility to apoptosis.
Eur. J. Immunol.
24:892-899[Medline].
|
| 28.
|
Stohlman, S. A.,
P. R. Brayton,
J. O. Fleming,
L. P. Weiner, and M. C. Lai.
1982.
Murine coronaviruses: isolation and characterization of two plaque morphology variants of the JHM neurotropic strain.
J. Gen. Virol.
63:265-275[Abstract/Free Full Text].
|
| 29.
|
Stohlman, S. A.,
C. C. Bergmann,
R. van der Veen, and D. Hinton.
1995.
Mouse hepatitis virus-specific cytotoxic T lymphocytes protect from lethal infection without eliminating virus from the central nervous system.
J. Virol.
69:684-694[Abstract].
|
| 30.
|
Stohlman, S. A.,
C. C. Bergmann,
M. T. Lin,
D. J. Cua, and D. Hinton.
1998.
CTL effector function within the central nervous system requires CD4+ T cells.
J. Immunol.
160:2896-2904[Abstract/Free Full Text].
|
| 31.
|
Tripp, R. A.,
S. Hou,
A. McMickle,
J. Houston, and P. C. Doherty.
1995.
Recruitment and proliferation of CD8+ T cells in respiratory virus infections.
J. Immunol.
154:6013-6021[Abstract].
|
| 32.
|
Wang, F. I.,
D. R. Hinton,
W. Gilmore,
M. D. Trousdale, and J. O. Fleming.
1992.
Sequential infection of glial cells by the murine hepatitis virus JHM strain (MHV-4) leads to a characteristic distribution of demyelination.
Lab. Investig.
66:744-753[Medline].
|
| 33.
|
Xu, J., and E. A. Ling.
1994.
Upregulation and induction of major histocompatibility complex class I and II antigens on microglial cells in early postnatal rat brain following intraperitoneal injections of recombinant interferon-gamma.
Neuroscience
60:959-967[CrossRef][Medline].
|
Journal of Virology, September 2000, p. 7903-7910, Vol. 74, No. 17
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Marques, C. P., Cheeran, M. C-J., Palmquist, J. M., Hu, S., Urban, S. L., Lokensgard, J. R.
(2008). Prolonged Microglial Cell Activation and Lymphocyte Infiltration following Experimental Herpes Encephalitis. J. Immunol.
181: 6417-6426
[Abstract]
[Full Text]
-
Barcia, C., Gomez, A., de Pablos, V., Fernandez-Villalba, E., Liu, C., Kroeger, K. M., Martin, J., Barreiro, A. F., Castro, M. G., Lowenstein, P. R., Herrero, M.-T.
(2008). CD20, CD3, and CD40 Ligand Microclusters Segregate Three-Dimensionally In Vivo at B-Cell-T-Cell Immunological Synapses after Viral Immunity in Primate Brain. J. Virol.
82: 9978-9993
[Abstract]
[Full Text]
-
Stohlman, S. A., Hinton, D. R., Parra, B., Atkinson, R., Bergmann, C. C.
(2008). CD4 T Cells Contribute to Virus Control and Pathology following Central Nervous System Infection with Neurotropic Mouse Hepatitis Virus. J. Virol.
82: 2130-2139
[Abstract]
[Full Text]
-
Gonzalez, J. M., Bergmann, C. C., Ramakrishna, C., Hinton, D. R., Atkinson, R., Hoskin, J., Macklin, W. B., Stohlman, S. A.
(2006). Inhibition of Interferon-{gamma} Signaling in Oligodendroglia Delays Coronavirus Clearance without Altering Demyelination. Am. J. Pathol.
168: 796-804
[Abstract]
[Full Text]
-
van Lint, A. L., Kleinert, L., Clarke, S. R. M., Stock, A., Heath, W. R., Carbone, F. R.
(2005). Latent Infection with Herpes Simplex Virus Is Associated with Ongoing CD8+ T-Cell Stimulation by Parenchymal Cells within Sensory Ganglia. J. Virol.
79: 14843-14851
[Abstract]
[Full Text]
-
Chen, A. M., Khanna, N., Stohlman, S. A., Bergmann, C. C.
(2005). Virus-Specific and Bystander CD8 T Cells Recruited during Virus-Induced Encephalomyelitis. J. Virol.
79: 4700-4708
[Abstract]
[Full Text]
-
MacNamara, K. C., Chua, M. M., Nelson, P. T., Shen, H., Weiss, S. R.
(2005). Increased Epitope-Specific CD8+ T Cells Prevent Murine Coronavirus Spread to the Spinal Cord and Subsequent Demyelination. J. Virol.
79: 3370-3381
[Abstract]
[Full Text]
-
Ramakrishna, C., Stohlman, S. A., Atkinson, R. A., Hinton, D. R., Bergmann, C. C.
(2004). Differential Regulation of Primary and Secondary CD8+ T Cells in the Central Nervous System. J. Immunol.
173: 6265-6273
[Abstract]
[Full Text]
-
Bergmann, C. C., Parra, B., Hinton, D. R., Ramakrishna, C., Dowdell, K. C., Stohlman, S. A.
(2004). Perforin and Gamma Interferon-Mediated Control of Coronavirus Central Nervous System Infection by CD8 T Cells in the Absence of CD4 T Cells. J. Virol.
78: 1739-1750
[Abstract]
[Full Text]
-
Moniuszko, M., Brown, C., Pal, R., Tryniszewska, E., Tsai, W.-P., Hirsch, V. M., Franchini, G.
(2003). High Frequency of Virus-Specific CD8+ T Cells in the Central Nervous System of Macaques Chronically Infected with Simian Immunodeficiency Virus SIVmac251. J. Virol.
77: 12346-12351
[Abstract]
[Full Text]
-
Bergmann, C. C., Parra, B., Hinton, D. R., Chandran, R., Morrison, M., Stohlman, S. A.
(2003). Perforin-Mediated Effector Function Within the Central Nervous System Requires IFN-{gamma}-Mediated MHC Up-Regulation. J. Immunol.
170: 3204-3213
[Abstract]
[Full Text]
-
Most, R. G. v. d., Murali-Krishna, K., Ahmed, R.
(2003). Prolonged presence of effector-memory CD8 T cells in the central nervous system after dengue virus encephalitis. Int Immunol
15: 119-125
[Abstract]
[Full Text]
-
Tschen, S.-I., Bergmann, C. C., Ramakrishna, C., Morales, S., Atkinson, R., Stohlman, S. A.
(2002). Recruitment Kinetics and Composition of Antibody-Secreting Cells Within the Central Nervous System Following Viral Encephalomyelitis. J. Immunol.
168: 2922-2929
[Abstract]
[Full Text]
-
Bergmann, C. C., Ramakrishna, C., Kornacki, M., Stohlman, S. A.
(2001). Impaired T Cell Immunity in B Cell-Deficient Mice Following Viral Central Nervous System Infection. J. Immunol.
167: 1575-1583
[Abstract]
[Full Text]