This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.

 Previous Article  |  Next Article 

Journal of Virology, August 2000, p. 7298-7306, Vol. 74, No. 16
0022-538X/00/$04.00+0

High-Efficiency Utilization of the Bovine Integrin alpha vbeta 3 as a Receptor for Foot-and-Mouth Disease Virus Is Dependent on the Bovine beta 3 Subunit

Sherry Neff, Peter W. Mason, and Barry Baxt*

Foot-and-Mouth Disease Research Unit, USDA Agricultural Research Service, Plum Island Animal Disease Center, Greenport, New York 11944

Received 6 March 2000/Accepted 19 May 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

We have previously reported that Foot-and-mouth disease virus (FMDV), which is virulent for cattle and swine, can utilize the integrin alpha vbeta 3 as a receptor on cultured cells. Since those studies were performed with the human integrin, we have molecularly cloned the bovine homolog of the integrin alpha vbeta 3 and have compared the two receptors for utilization by FMDV. Both the alpha v and beta 3 subunits of the bovine integrin have high degrees of amino acid sequence similarity to their corresponding human subunits in the ectodomains (96%) and essentially identical transmembrane and cytoplasmic domains. Within the putative ligand-binding domains, the bovine and human alpha v subunits have a 98.8% amino acid sequence similarity while there is only a 93% similarity between the beta 3 subunits of these two species. COS cell cultures, which are not susceptible to FMDV infection, become susceptible if cotransfected with alpha v and beta 3 subunit cDNAs from a bovine or human source. Cultures cotransfected with the bovine alpha vbeta 3 subunit cDNAs and infected with FMDV synthesize greater amounts of viral proteins than do infected cultures cotransfected with the human integrin subunits. Cells cotransfected with a bovine alpha v subunit and a human beta 3 subunit synthesize viral proteins at levels equivalent to those in cells expressing both human subunits. However, cells cotransfected with the human alpha v and the bovine beta 3 subunits synthesize amounts of viral proteins equivalent to those in cells expressing both bovine subunits, indicating that the bovine beta 3 subunit is responsible for the increased effectiveness of this receptor. By engineering chimeric bovine-human beta 3 subunits, we have shown that this increase in receptor efficiency is due to sequences encoding the C-terminal one-third of the subunit ectodomain, which contains a highly structured cysteine-rich repeat region. We postulate that amino acid sequence differences within this region may be responsible for structural differences between the human and bovine beta 3 subunit, leading to more efficient utilization of the bovine receptor by this bovine pathogen.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Foot-and-mouth disease virus (FMDV), an Aphthovirus in the Picornaviridae family, is the cause of foot-and-mouth disease, a highly infectious disease of domestic livestock. The virus initiates infection by binding to its cellular receptor via an arginine-glycine-aspartic acid (RGD) sequence found within a surface protrusion consisting of the loop between the beta G and beta H strands (G-H loop) of the capsid protein VP1 (1, 6, 23, 42, 45). While FMDV can utilize other receptors on cultured cells, such as the Fc receptor (7, 44) or heparan sulfate (3, 25, 36, 47), these receptors do not require the RGD sequence (43, 47). We have demonstrated that antibodies to the integrin receptor alpha vbeta 3 can inhibit adsorption and plaque formation by FMDV (11). Furthermore, we have also shown that the virus, which is virulent for cattle, can infect only cells expressing this integrin receptor and that site-directed mutants of these viruses lacking an RGD sequence are not capable of infecting cells expressing alpha vbeta 3 (45, 47).

Integrins are heterodimeric molecules, consisting of alpha  and beta  subunits which interact noncovalently at the cell surface and have a wide species distribution (35). They are involved in extracellular matrix and cell-cell interactions and also serve as signal-transducing receptors (29). A total of 16 alpha  and 8 beta  subunits have been described, giving rise to 22 different integrins, each with its own ligand-binding specificity, and 7 of which, including alpha vbeta 3, bind to their natural ligands via an RGD sequence (22, 35). Electron microscopic visualization of integrins reveals a globular structure, presumably the ligand-binding region combining elements of both subunits with two stalk-like structures extending to the cell surface (16, 49).

The alpha vbeta 3 integrin is one of two receptors within the class of integrins called cytoadhesins (29). The beta 3 subunit is found only complexed with one other subunit, alpha IIb, while the alpha v subunit can complex with four additional beta  subunits (beta 1, beta 5, beta 6, and beta 8) (35). Although alpha vbeta 3 was originally called the vitronectin receptor, it can bind to other ligands (33). While it is clear that both the alpha  and beta  subunits of integrins structurally contribute to ligand binding (22, 34), there are specific regions of the alpha v (41, 57) and beta 3 (13, 19, 39, 56, 61, 62) subunits that have been identified as directly interacting with ligands. At least two other picornaviruses can utilize alpha vbeta 3 to initiate infection, coxsackievirus A9 (CAV9) (53) and echovirus 9 (48). In addition, human adenovirus utilizes integrins alpha vbeta 3 and alpha vbeta 5 to facilitate internalization (64); two hantaviruses, which cause different human disease syndromes, utilize alpha vbeta 3 and alpha IIbbeta 3 to mediate cellular entry (26, 27); and human parechovirus 1 (formerly echovirus 22) may utilize the alpha vbeta 1 integrin as a receptor (50).

While previous studies have shown that FMDV can utilize the human (47) and simian (11) homologs of the alpha vbeta 3 integrin to infect cells, this virus does not cause disease in humans (4). Therefore, we have characterized the bovine homolog of this integrin to determine how it interacts with this bovine pathogen. These studies demonstrate that FMDV utilizes the bovine integrin with much greater efficiency than it utilizes the human integrin, and we show that this increased efficiency is due to bovine sequences located within the C-terminal one-third of the beta 3 subunit ectodomain.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

cDNA cloning. Single-stranded cDNA was reverse transcribed from bovine lung poly(A)+ RNA (Clontech) using Superscript II reverse transcriptase (Life Technologies) and an oligo(dT)18 primer. The bovine alpha v cDNA was generated in two pieces by a 30-cycle PCR using Taq polymerase (Boehringer Mannheim) and the following sets of primers, which introduce a silent mutation creating a BamHI restriction endonuclease site that could be used to recreate complete alpha v coding sequences: 5'CGCGCACCCCGGCGATGGCT3' plus 5'CCATCGGATCCGCGATCCATG3', and 5'GGATCCGATGGCAAACTCCAGGAG3' plus 5'GGAATTCCTTAAGTTTCTGAGTTTCCTTCACC 3'. The resulting PCR products were ligated into the vector pCR2.1 (Invitrogen) and sequenced. Plasmid DNA containing the 3' piece of bovine alpha v cDNA was ligated to the 5' bovine alpha v cDNA utilizing this synthetic BamHI site. The resulting full-length alpha v cDNA fragment was inserted into the vector pcDNA3.1/Zeo(-) (Invitrogen) to create pBovalpha vZEO.

The cDNA encoding the mature bovine beta 3 subunit was generated by a 30-cycle PCR using Advantage KlenTaq polymerase mix (Clontech) and the following primers, which introduce a silent mutation creating an MluI site following the predicted N-terminal signal peptide cleavage site: 5'CCACGCGTGGTGTGAGCTCCTG3' plus 5'GGATCCTAAGGCCCCGGTACGTGATATTG3'. To generate a signal peptide sequence for use with the bovine beta 3 coding region, human beta 3 cDNA (beta 3/pIAP58) (14, 40, 47) was used as a template for 15 cycles of PCR amplification with Advantage KlenTaq polymerase mix and the following primers, which also introduce a silent mutation creating an MluI site in frame with the bovine open reading frame: 5'CAGATGCGAGCGCGGCCGC3' plus 5'CGGGATCCTTAAGTGCCCCGGTACGTGATATTG3'. The PCR products were inserted into the pCR-Blunt II-TOPO vector (Invitrogen) and sequenced. The cDNA encoding mature bovine beta 3 was ligated to the human signal peptide sequence and inserted into pcDNA3.1/Zeo(-) to create pBovbeta 3ZEO. The human alpha v-encoding plasmid, pHumalpha vZEO, has been described previously (47). The human beta 3-encoding plasmid, beta 3/pIAP58 (14, 40, 47), was inserted into pcDNA3.1/Zeo(-) to generate pHumbeta 3ZEO.

Generation of chimeric beta 3 subunits. Chimeric cDNAs for the beta 3 integrin were created using a KpnI site shared by pBovbeta 3ZEO and pHumbeta 3ZEO at codon 136. Plasmid phkbbeta 3 contained the first 136 codons of the human beta 3 subunit and the remaining codons from the bovine beta 3 subunit. Plasmid pbkhbeta 3 was the inverse chimera and contained bovine sequences to codon 136 and human sequences for the remainder of the subunit. The chimeric cDNAs phsbbeta 3 and pbshbeta 3 were created using a similar strategy and a SmaI site at codon 488 of pBovbeta 3ZEO and pHumbeta 3ZEO. The resulting constructs were sequenced around the restriction sites to ensure their identity.

Sequencing. Automated sequencing was performed on an Applied Biosystems 370A sequencer with an XL upgrade, using the ABI Prism Big Dye terminator cycle-sequencing ready reaction kit (Perkin-Elmer) as described by the manufacturer. Sequence analysis was done using the Lasergene analysis software package (DNASTAR Inc.). The nucleotide sequences for the human alpha v and beta 3 subunits were from GenBank (accession numbers M14648 [60] and M35999 [24], respectively).

Coupled in vitro transcription-translation. Plasmid DNA (1 µg) was used in either a wheat germ extract or rabbit reticulocyte lysate TNT Quick coupled transcription-translation system (Promega) in the presence of [35S]methionine (Amersham) as described by the manufacturer. The resulting protein products were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 7.5% gel.

Viruses and cells. FMDV type A12, strain 119ab, was derived from the infectious cDNA clone pRMC35 (52). An antigenic variant of type A12, harboring the VP1 sequence present in a bovine tongue tissue-propagated type A12 (vRM-SSP), has been described previously (51). The cattle-virulent variant derived from infectious cDNA containing capsid sequences isolated from a vaccine seed stock of type O1Campos (vCRM8) has also been described previously (54). COS-1 cells were maintained on Dulbecco's minimal essential medium (Life Technologies Inc.) containing 10% calf serum, an additional 2 mM L-glutamine, 1 mM sodium pyruvate, 10 U of penicillin G per ml, 10 U of streptomycin sulfate per ml, and 0.25 µg of amphotericin B per ml.

Transient expression of integrin subunits in COS-1 cells. Cells were plated at a density of 105 cells/well on six-well tissue culture dishes the day before transfection. Transfections were performed using 2.0 µg of each integrin-encoding plasmid mixed with the transfection reagent FuGENE 6 (Roche Molecular Biochemicals) as specified by the manufacturer. After incubation at 37°C overnight, the cells were trypsinized and replated onto 2 wells of a 24-well tissue culture dish. After an additional overnight incubation at 37°C, cells in one well of each transfected condition were infected with FMDV and cells in the other well were analyzed for integrin expression by immunohistochemistry (IHC).

Immunohistochemistry. Transfected cells were fixed on ice for 5 min with acetone-methanol (50:50). Fixed cells were rehydrated with minimal essential medium containing 0.2% bovine serum albumin, 50 mM HEPES (pH 7.5), and 1% normal horse serum. The cells were reacted with a 1:500 dilution of the anti-alpha vbeta 3 monoclonal antibody (MAb) LM609 (MAB1976; Chemicon International Inc.) (17) for 30 min at 37°C. Primary-antibody binding was detected using an alkaline phosphatase avidin-biotin system and biotinylated horse anti-mouse immunoglobulin G (Vectastain Elite ABC kit; Vector Laboratories). Bound phosphatase was visualized using the Vector VIP substrate kit (Vector Laboratories).

Viral replication assays. Transfected and nontransfected COS-1 cells were infected and analyzed as previously described (47). Briefly, cells were infected with various FMDV serotypes at a multiplicity of infection (MOI) of 10 PFU/cell and labeled overnight, beginning at 4 h after infection, with 50 to 75 µCi of [35S]methionine at 37°C. Cell lysates were prepared in 1% Triton X-100, trichloroacetic acid (TCA)-precipitable counts per minute (cpm) were determined, and radioimmunoprecipitation (RIP) was preformed as previously described (5) using anti-FMDV type A12 MAb 6EE2 (8) for type A12- and vRM-SSP-infected cells and anti-FMDV type O1 MAb 10GA4 (59) for vCRM8-infected cultures. Equal amounts of TCA-precipitable CPM were immunoprecipitated and analyzed by SDS-PAGE using a 10% polyacrylamide gel.

Nucleotide sequence accession numbers. Nucleotide sequences for the bovine alpha v and beta 3 cDNAs have been submitted to GenBank and have been assigned accession numbers AF239958 and AF239959, respectively.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

cDNA cloning of the bovine integrin alpha vbeta 3 subunits. The identification of alpha vbeta 3 as the receptor for virulent forms of FMDV (47) utilizing human alpha vbeta 3 cDNAs led us to examine the available integrin subunit sequences. Interspecies comparisons for both the alpha v (63) and beta 3 (18) subunits have shown that there are differences in the deduced amino acid sequences among the species sequenced to date. For this reason, we thought it important to obtain cDNAs encoding alpha vbeta 3 from a species that is naturally susceptible to FMDV infection, such as cattle. PCR with cDNA from bovine lung tissue and primers based on known human and mouse integrin sequences (18, 60, 63, 65) generated fragments of the expected sizes for both the alpha v and beta 3 subunits. These fragments were ligated and inserted into expression vectors that would allow in vitro transcription-translation analysis and eukaryotic expression. The complete coding sequence for the bovine alpha v subunit cDNA was 3,144 bp coding for a 1,048-amino acid protein. The encoded protein consists of a 30-residue signal peptide, a 963-residue extracellular ectodomain, a 23-residue transmembrane domain, and a 32-residue cytoplasmic domain. The complete coding sequence for the bovine beta 3 subunit cDNA was 2,364 bp coding for a 788-amino-acid protein. Since we were unable to generate a fragment which included the authentic bovine beta 3 signal peptide sequence, we removed the coding region for this peptide from the human beta 3 cDNA plasmid and ligated it to the remainder of the bovine beta 3 cDNA as described in Materials and Methods. Thus, the encoded protein consists of the 26-residue human signal peptide, a 692-residue extracellular ectodomain, a 23-residue transmembrane domain, and a 47-residue cytoplasmic domain.

Coupled in vitro transcription-translation reactions were performed using the cDNA constructs encoding both the human and the bovine alpha v and beta 3 subunits to determine if the bovine constructs were capable of generating proteins in the same size range as the human subunits. Radiolabeled protein was generated and separated by SDS-PAGE (7.5% polyacrylamide) as described in Materials and Methods. Transcription-translation of the bovine alpha v subunit in a rabbit reticulocyte lysate translation system generated a product that was comparable in size, based on migration in a denaturing gel, to the human alpha v subunit (Fig. 1a). In contrast, in the rabbit reticulocyte lysate system, the bovine beta 3 subunit migrated faster, to an apparent lower molecular weight than the human subunit did (Fig. 1a). Since differences in glycosylation may account for differences in migration on SDS-PAGE, the transcription-translation reactions were repeated utilizing a wheat germ extract. In contrast to the result seen in the rabbit reticulocyte lysate, the bovine and human beta 3 subunits synthesized in this system were comparable in size, as were the alpha v subunits (Fig. 1b). While O-linked glycosylation occurs in rabbit reticulocyte lysates in the absence of microsomal membranes, this posttranslational modification cannot take place in wheat germ extracts in the absence of membranes. In contrast, N-linked glycosylation occurs only in the presence of microsomal membranes in either extract (38, 58). Since we did not add microsomal membranes to either lysate, differences seen between the bovine and human beta 3 subunits in the rabbit reticulocyte lysate may have been due to differences in glycosylation. Examination of potential O-linked glycosylation sites in the beta 3 subunits revealed differences between human and bovine beta 3 subunits which may account for the variation in apparent molecular weight seen in the rabbit reticulocyte lysate system (results not shown).


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 1.   Transcription-translation of cloned bovine integrin subunits. Plasmids containing sequences representing bovine alpha v (pBovalpha vZEO), bovine beta 3 (pBovbeta 3ZEO), human alpha v (pHumalpha vZEO), or human beta 3 (pHumbeta 3ZEO) integrin sequences were analyzed for protein expression by coupled in vitro transcription-translation using either a rabbitreticulocyte lysate (a) or wheat germ extract system (b), as described in Materials and Methods. Translation products were analyzed by SDS-PAGE (7.5% polyacrylamide). Bovine and human subunits are indicated by b and h, respectively, above the lanes.

Sequence comparisons of bovine and human integrin subunits. The cloned bovine subunit cDNAs were sequenced using automated sequencing, as described in Materials and Methods, and compared with the reported human alpha v and beta 3 subunit sequences (24, 60). Analysis of the two bovine subunit constructs revealed a high degree of sequence similarity to their counterpart human homolog subunits. Alignment of DNA sequence using the Martinez/Needlemen-Wunsch alignment method, with a gap penalty of 1.10 and a gap length penalty of 0.33, showed that the sequence similarities between the bovine and human alpha v and beta 3 extracellular ectodomains were 93.6 and 90.1%, respectively (Table 1). When the deduced amino acid sequences within this region were compared by Lipman-Pearson alignment (gap penalty of 4 and gap length penalty of 12), the sequence similarity was about 96% for both subunits (Table 1). The transmembrane and cytoplasmic domains of both bovine subunits displayed the highest level of amino acid similarity to their human homologs: the alpha v subunits were identical in this domain, and the beta 3 subunits had a 99.9% similarity even though the nucleotide sequence similarity was rather low at 88% (Table 1). We also compared sequences which lie within the putative ligand-binding domains of these subunits. The ligand-binding domains of the human alpha v and beta 3 subunits have been determined using a number of methods, most prominently photoaffinity cross-linking and generation of chimeric receptors with closely related alpha v and beta 3 subunits. These studies have estimated that the ligand-binding regions for the alpha v and beta 3 subunits lie between amino acid residues 1 and 340 (41, 57) and between residues 85 and 207 (13, 19, 39, 56, 61, 62), respectively (amino acid residue 1 is the first amino acid after cleavage of the signal sequence). Within this domain, the amino acid sequence similarity between bovine and human sequences was quite high for the alpha v subunit (98.8%) but was only 93.5% for the beta 3 subunit.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Nucleotide and encoded amino acid sequence similarities between the human and bovine alpha v and beta 3 integrin subunits

Transient expression of integrin subunits in COS-1 cells. Cells were cotransfected with each integrin subunit using FuGENE 6 as described in Materials and Methods. The cells were grown for 48 h, fixed, and immunostained using the anti-alpha vbeta 3 MAb LM609. Figure 2 shows that cells expressing either bovine or human alpha vbeta 3 were stained equally well with this MAb, which reacts only with the heterodimeric alpha vbeta 3 integrin (17). This confirms previously reported results showing that LM609, which was generated against the human integrin, also reacts with the complete bovine integrin (12, 28, 55). Furthermore, these results indicate that both integrins were expressed to approximately comparable levels in the COS-1 cells. We also examined the expression of the alpha vbeta 3 integrin in cells transfected with mixed bovine-human subunits. The results in Fig. 2 show that these cultures also expressed the integrin to levels comparable to those seen in either complete bovine or complete human integrin expression. Because integrins can be composed of different combinations of alpha  and beta  subunits (35), transfections were also done with the individual subunits and cells were analyzed by IHC. In all cases, no staining above the level seen in the control cells was observed (data not shown), indicating that the staining obtained in cells transfected with both subunits was not due to the formation of heterodimers between the transfected subunits and endogenous monkey integrin subunits.


View larger version (72K):
[in this window]
[in a new window]
 
FIG. 2.   Analysis of integrin expression in transfected COS-1 cells. Cells were transfected with integrin subunit-encoding plasmids, as shown above each panel, and integrin expression was analyzed by IHC with MAb LM609 48 h after transfection, as described in Materials and Methods.

In the experiments reporting FMDV replication in integrin subunit-transfected cells shown below, parallel cultures were always examined for integrin expression by IHC and only experiments where the integrin expression in all cultures was qualitatively equivalent are reported. In addition, in some experiments, cells were analyzed for integrin expression using fluorescence-activated cell sorting (FACS), and these results were comparable to those seen using IHC analysis (data not shown).

Replication of FMDV in integrin subunit-transfected cells. COS-1 cells were transfected with complete bovine or human integrin subunit cDNAs or with mixed bovine-human subunits and infected with FMDV as outlined in Materials and Methods. We used three different viruses for these studies: our tissue culture-adapted type A12, an A12 variant containing sequences isolated from the tongue of an infected bovine (vRM-SSP) (51), and a highly cattle-virulent variant of type O1Campos (vCRM8) (54). These viruses utilize only alpha vbeta 3 as a receptor to infect cultured cells (47). Transfected-infected cells were labeled overnight with [35S]methionine, and lysates were analyzed by RIP and SDS-PAGE as described in Materials and Methods. In all of these assays, equal numbers of TCA-precipitable cpm and equal amounts of protein were immunoprecipitated within each experiment. This normalized the various conditions and allowed us to make semiquantitative comparisons of the levels of viral protein synthesis. The results in Fig. 3 show the presence of viral proteins only in infected cells expressing either bovine or human alpha vbeta 3, confirming our previous findings obtained in experiments with human integrin-transfected cells (47).


View larger version (83K):
[in this window]
[in a new window]
 
FIG. 3.   Analysis of viral protein synthesis in COS-1 cells transfected with integrin subunit cDNAs. Cells were transfected with plasmids encoding human or bovine integrin subunits as shown. Transfected cells were infected with FMDV type A12, vRM-SSP, or vCRM8 at an MOI of 10 PFU/cell. Cells were labeled with [35S]methionine, RIP was performed on cell lysates, and the products were analyzed by SDS-PAGE (10% polyacrylamide). Locations of viral structural proteins are denoted on the left. con, nontransfected cells; M, marker viral proteins from FMDV-infected BHK-21 cells also labeled with [35S]methionine; bov, bovine integrin subunits; hum, human integrin subunits.

A comparison of the level of viral protein synthesis in cultures expressing the different integrins, however, showed that viral protein synthesis was greater in cultures transfected with the bovine integrin (Fig. 3), even though the bovine and human integrins were expressed to the same level, as determined by IHC. We also examined the level of viral protein synthesis in cells transfected with mixed bovine-human integrin subunits. The results in Fig. 3 show that with all three viruses used, the level of viral protein synthesis was always greater when the bovine beta 3 was expressed, regardless of which alpha v subunit was transfected. In fact, expression of the bovine beta 3 subunit along with the human alpha v subunit resulted in a level of viral protein synthesis comparable to that seen with the complete bovine integrin. The differences in the level of viral protein synthesis appeared to be more pronounced when the cells were infected with the laboratory strain A12 virus than when they were infected with either of the other two animal-derived viruses. However, it is clear in all cases that viral replication, as measured in this assay, was greater when the bovine alpha vbeta 3 integrin was used as a receptor. In nontransfected COS-1 cells, there was a very low level of viral protein synthesis in cells infected with the vCRM8 virus (Fig. 3). We are not sure why this occurred; however, it may be the result of a low level of virus which utilizes cell surface heparan sulfate as a receptor (47, 54), either present in the original seed or generated during the overnight incubation.

FMDV infection in cells expressing chimeric bovine-human beta 3 subunit receptors. Since the results presented in the previous section indicated that the bovine beta 3 subunit was necessary for the higher level of viral protein synthesis seen in transfected-infected cells, we generated chimeric bovine-human beta 3 subunits to delineate which portions of the subunit were responsible for this phenomenon. To do this, we took advantage of two unique restriction sites that are conserved in both the bovine and human beta 3 cDNAs. A schematic diagram for the chimeric beta 3 subunits is shown in Fig. 4a. The first two were created using a KpnI restriction site, which facilitated a reciprocal swap within the ligand-binding domain at amino acid residue 136. These swaps generated the proteins hkbbeta 3, which contains human sequences from the N terminus to codon 136 and bovine sequences for the rest of the subunit, and bkhbeta 3, which contains bovine sequences from the N terminus to codon 136 and human sequences for the rest of the subunit. The second set of chimeric beta 3 subunits were created using a SmaI restriction site, which allowed a reciprocal swap within the C-terminal one-third of the ectodomain at amino acid residue 488, far outside the ligand-binding domain. These swaps generated the proteins hsbbeta 3, which contains human sequences from the N terminus to codon 488 and bovine sequences for the rest of the subunit, and bshbeta 3, which contains bovine sequences from the N terminus to codon 488 and human sequences for the rest of the subunit.


View larger version (67K):
[in this window]
[in a new window]
 
FIG. 4.   Analysis of viral protein synthesis in COS-1 cells transfected with bovine-human chimeric beta 3 subunits. (a) Schematic diagram of chimeric beta 3 subunits, showing the locations of the ligand-binding domain (LBD), transmembrane domain (TMD), and cytoplasmic domain (CD), as well as the locations of the KpnI (codon 136) and SmaI (codon 488) sites used to generate them (see Materials and Methods). The white background with the black stipples represents human sequences, and the black background with the white stipples represents bovine sequences. (b) FMDV type A12-infected-radiolabeled cell lysates prepared from cells cotransfected with a bovine alpha v subunit and the beta 3 subunits shown in panel a were analyzed as described in the legend to Fig. 3 and Materials and Methods.

These chimeras and the wild-type beta 3 subunit were cotransfected into COS-1 cells, along with the human or bovine alpha v subunit. The resulting cultures were checked for alpha vbeta 3 expression level by IHC, infected with FMDV type A12, labeled overnight, and analyzed by RIP and SDS-PAGE. The results of transfections with the intact bovine and human beta 3 subunits confirmed the importance of the bovine beta 3 subunit in increased receptor utilization (Fig. 4b). The results of transfections with the chimeric beta 3 subunits showed that the hkbbeta 3 or hsbbeta 3 chimeras supported replication to the same level as the intact bovine beta 3 did. Interestingly, these results suggest that the presence of bovine or human sequences from the N terminus of the beta 3 subunit to amino acid residue 488, including the ligand-binding domain, did not influence the level of viral protein synthesis observed. In contrast, the higher levels of viral protein synthesis were observed only when the beta 3 subunit contained bovine sequences downstream from codon 488 (hkbbeta 3 and hsbbeta 3). To rule out any influence of the bovine alpha v subunit, we repeated the experiment using the human alpha v subunit and obtained similar results to those seen in Fig. 4b (data not shown).

Sequence comparison within the C-terminal region of the beta 3 subunit ectodomain. The beta 3 subunit has a high cysteine content, as do all integrin beta  subunits (15). The bovine subunit contains 54 cysteine residues, 30 of which are located within a region of four tandem amino acid repeats near the C terminus of the ectodomain. This is within the region downstream from amino acid residue 488, which appears to be responsible for the observed increase in viral protein synthesis. A comparison of the amino acid sequences of the bovine and human beta 3 subunits in this region is shown in Fig. 5. The vertical arrow at amino acid residue 488 represents the location of the SmaI restriction endonuclease site, and the horizontal arrows show the four tandem repeats. It can be seen that downstream from residue 488 there are only seven amino acid residues which differ between the bovine and human subunits. However, all of the cysteines are conserved, as they are in the entire subunit, with the exception of one, at residue 503, within the second repeat region, which is an arginine in the bovine integrin. The significance of changes within this region on the ability of the subunit to function as a viral receptor is examined in Discussion.


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5.   Comparison of amino acid sequences within the cysteine-rich repeat region between bovine and human beta 3 subunits. Deduced amino acid sequences of the bovine and human beta 3 subunits from amino acid residue 394 to the last residue in the subunit ectodomain (residue 692) are shown. The conserved sequences (con) are shown in lowercase type, with the exception of the cysteine residues, which are capitalized. Sequences which differ between bovine (bov) and human (hum) subunits are shown in capital letters. The horizontal arrows indicate the location of the four cysteine-rich repeats, and the vertical arrow indicates the location of the SmaI site. The dotted line represents the putative disulfide bond assignment for cysteine 503 in the human beta 3 subunit (15).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Previous results have implicated integrin alpha vbeta 3 as a receptor for FMDV by demonstrating inhibition of infection using integrin-specific antibodies (11) and by demonstrating that cells transfected with cloned human integrin subunit cDNAs became susceptible to infection by FMDV (47). Since these studies were performed with cDNAs encoding integrin subunits from a host that is not susceptible to foot-and-mouth disease (see Introduction), we have repeated these studies with molecularly cloned bovine alpha v and beta 3 cDNAs. The results of these studies indicate that FMDV was able to utilize the bovine integrin more efficiently than it utilized the human homolog, and this increased efficiency appears to correlate with the presence of the bovine beta 3 subunit.

We have utilized transient expression of alpha v and beta 3 subunits of bovine and human origin in COS-1 cells to examine receptor utilization by FMDV. Using this system, we have examined the replication of our laboratory strain of FMDV (type A12), its bovine tongue-derived variant, vRM-SSP (51), and the highly cattle-virulent type O1Campos variant, vCRM8 (54), which all utilize only the integrin alpha vbeta 3 as receptor (47). These experiments showed that for these three viruses, the cotransfection of cells with a bovine beta 3 subunit and either a bovine or human alpha v subunit resulted in the expression of a more efficiently utilized receptor than did the cotransfection of cells with both human subunits or bovine alpha v and human beta 3 subunits.

To determine the regions of the bovine beta 3 subunit that might be responsible for the increased efficiency of use as an FMDV receptor, we generated chimeric bovine-human beta 3 subunit cDNAs and tested their efficiency as receptors for type A12 FMDV. The results of these studies indicated that bovine sequences downstream from codon 488, outside of the putative ligand-binding domain, appeared to be responsible for the increased efficiency of the bovine receptor (see Results) (Fig. 4).

Comparison of the amino acid sequences of the bovine and human beta 3 subunit between codon 488 and the C terminus of the subunit reveals virtually identical transmembrane and cytoplasmic domains, with only seven amino acid changes in the ectodomain (Fig. 5). This region of the subunit is rich in cysteines which contribute to the overall structure of the integrin through disulfide bonding (15). In the mature bovine beta 3 subunit, 7% of the amino acids are cysteines (a total of 54 cysteine residues). Thirty of these cysteine residues are within a region of four tandem repeats within the integrin stalk region, known as the cysteine-rich repeats (15, 30, 33, 35). A cysteine residue just upstream of the first cysteine-rich repeat region, at codon 435, forms a disulfide bond with a cysteine near the N terminus, at codon 5, and probably contributes to the formation of the beta 3 globular head that interacts with a similar structure on the alpha  subunit to form the complete ligand-binding region (16, 49). The SmaI site at codon 488 occurs at the beginning of the second repeat (Fig. 5). Within the cysteine-rich repeat region of all the beta  subunits, the positions of the cysteines are highly conserved, with seven residues in the first repeat and eight residues in the second through fourth repeats. Similar cysteine-rich repeat regions are also found in laminin B chains and epidermal growth factor (10). Examination of the amino acid sequence comparisons between the bovine and human subunits within this region reveals that the cysteine found at residue 503 in the human subunit has been changed to an arginine in the bovine subunit. Thus, the region of the bovine beta 3 subunit that confers the higher efficiency of utilization of the subunit as a receptor for FMDV is missing one cysteine residue.

There are six other amino acid changes within the beta 3 region that confers increased receptor efficiency (Fig. 5), and we have not yet determined which of these changes may play a role in receptor efficiency. The loss of the cysteine at residue 503, however, is an intriguing change. The overall structure of the beta  subunits, based on primary sequence, is conserved among many species, and much of that structure appears to be dependent on the disulfide bonding between cysteine residues (30). Therefore, reports that cysteine 503 in the human beta 3 subunit forms a disulfide bond with cysteine 536 in the third repeat region (15) makes the absence of a cysteine at this position particularly interesting. The cysteine-rich repeat region has been implicated in the modulation of integrin activation and ligand-binding activity. A naturally occurring mutation within this region in the human beta 3 subunit is responsible for the activation of both alpha vbeta 3 and alpha IIbbeta 3 (37), and a MAb which binds to the cysteine-rich repeat region of the beta 1 subunit increases the affinity of the alpha 5beta 1 integrin for its natural ligand, fibronectin (21). In addition, binding of beta 3 integrins to their ligands induces conformational changes within the subunit, exposing new epitopes, defined by their ability to bind certain MAbs. These new epitopes are known as ligand-induced binding sites (LIBS). The conformational changes that expose the LIBS can increase the affinity of the beta 3 receptor for its ligand (20). Mapping of a number of LIBS has shown that some of them reside within the cysteine-rich repeat region (32).

The experiments reported here are indirect measures of receptor utilization and have not addressed whether the bovine receptor has a higher affinity for the virus or whether the C-terminal region of the ectodomain may be mediating an event subsequent to adsorption, either penetration or eclipse. However, an examination of virus binding in relation to the level of viral protein synthesis observed in transfected-infected cells indicated that cells transfected with bovine subunit cDNA adsorbed higher levels of type A12 virus than did cells transfected with human integrin cDNAs (data not shown). Furthermore, analysis of infected cells by IHC using a virus-specific MAb showed that increased numbers of infected cells were present in cultures transfected with the bovine beta 3 subunit (not shown).

Finally, it is interesting to speculate, from the standpoint of receptor utilization, why foot-and-mouth disease is limited to cloven-hoofed animals. Results from this and previous studies have shown that FMDV can utilize human and simian alpha vbeta 3 as a receptor in cell culture (11, 47). However, it is quite clear that the virus replicates to a greater extent in cells expressing the bovine integrin, specifically the cysteine-rich repeat region of the beta 3 subunit of that integrin, which has a high degree of structural conservation among all beta  subunits (30). Thus, it is possible that FMDV evolved into a disease of cloven-hoofed livestock because the structure of their alpha vbeta 3 receptors resulted in a more advantageous "fit" with the viral surface that would, in turn, lead to much greater viral replication and disease within these species. However, since this integrin probably performs similar functions in a wide variety of species, the structural differences cannot be radically different, as evidenced by the high degree of sequence similarity between the bovine and human integrins. It is also important to note that receptors alone may not necessarily determine FMDV species tropism. Recent results have shown that a type O virus, isolated from an outbreak which occurred only in swine in Taiwan in 1997, contained a deletion in nonstructural protein 3A, which led to restricted growth in bovine cells and attenuation in cattle (9). In the case of poliovirus, which causes disease only in primates, a murine homolog of the poliovirus receptor has been found and is unable to bind the virus (46). This inactivity of the murine homolog has been mapped to a few amino acid differences with the human homolog in the first immunoglobulin domain of the receptor (2, 31). We have transfected COS-1 cells with the murine beta 3 subunit (a kind gift from Erich Mackow and Eric Brown) and have found that viral protein synthesis was comparable to that seen with the human receptor (data not shown). We are currently cloning the porcine alpha v and beta 3 subunits, and it will be interesting to see whether the changes within the beta 3 cysteine-rich region are similar those seen in the bovine integrin.


    ACKNOWLEDGMENTS

We thank Michael LaRocca for excellent technical assistance and William Golde for performing the FACS analysis.


    FOOTNOTES

* Corresponding author. Mailing address: USDA ARS, Plum Island Animal Disease Center, P.O. Box 848, Greenport, NY 11944-0848. Phone: (631) 323-3354. Fax: (631) 323-2507. E-mail: bbaxt{at}piadc.ars.usda.gov.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Acharya, R., E. Fry, D. Stuart, G. Fox, D. Rowlands, and F. Brown. 1989. The three-dimensional structure of foot-and-mouth disease virus at 2.9 Å resolution. Nature 337:709-716[CrossRef][Medline].
2. Aoki, J., S. Koike, I. Ise, Y. Sato-Yoshida, and A. Nomoto. 1994. Amino acid residues on human poliovirus receptor involved in interaction with poliovirus. J. Biol. Chem. 269:8431-8438[Abstract/Free Full Text].
3. Baranowski, E., C. M. Ruiz-Jarabo, N. Sevilla, D. Andreu, E. Beck, and E. Domingo. 2000. Cell recognition by foot-and-mouth disease virus that lacks the RGD integrin-binding motif: flexibility in aphthovirus receptor usage. J. Virol. 74:1641-1647[Abstract/Free Full Text].
4. Barteling, S. J., and J. Vreeswijk. 1991. Development in foot-and-mouth disease vaccines. Vaccine 9:75-88[CrossRef][Medline].
5. Baxt, B. 1987. Effect of lysosomotropic compounds on early events in foot-and-mouth disease virus replication. Virus Res. 7:257-271[CrossRef][Medline].
6. Baxt, B., and Y. Becker. 1990. The effect of peptides containing the arginine-glycine-aspartic acid sequence on the adsorption of foot-and-mouth disease virus to tissue culture cells. Virus Genes 4:73-83[CrossRef][Medline].
7. Baxt, B., and P. W. Mason. 1995. Foot-and-mouth disease virus undergoes restricted replication in macrophage cell cultures following Fc receptor-mediated adsorption. Virology 207:503-509[CrossRef][Medline].
8. Baxt, B., D. O. Morgan, B. H. Robertson, and C. H. Timpone. 1984. Epitopes on foot-and-mouth disease virus outer capsid protein VP1 involved in neutralization and cell attachment. J. Virol. 51:298-305[Abstract/Free Full Text].
9. Beard, C. W., and P. W. Mason. 2000. Genetic determinants of altered virulence of Taiwanese foot-and-mouth disease virus. J. Virol. 74:987-991[Abstract/Free Full Text].
10. Berg, R. W., E. Leung, S. Gough, C. Morris, W.-P. Yao, S.-X. Wang, J. Ni, and W. Krissansen. 1999. Cloning and characterization of a novel beta  integrin-related cDNA coding for the protein TIED ("ten beta  integrin EGF-like repeat domains") that maps to chromosome band 13q33: a divergent stand-alone integrin stalk structure. Genomics 56:169-178[CrossRef][Medline].
11. Berinstein, A., M. Roivainen, T. Hovi, P. W. Mason, and B. Baxt. 1995. Antibodies to the vitronectin receptor (integrin alpha vbeta 3) inhibit binding and infection of foot-and-mouth disease virus to cultured cells. J. Virol. 69:2664-2666[Abstract].
12. Bhattacharya, S., F. Chenzhong, J. Bhattacharya, and S. Greenberg. 1995. Soluble ligands of the alpha vbeta 3 integrin mediate enhanced tyrosine phosphorylation of multiple proteins in adherent bovine pulmonary artery endothelial cells. J. Biol. Chem. 270:16781-16787[Abstract/Free Full Text].
13. Bitan, G., L. Scheibler, Z. Greenberg, M. Rosenblatt, and M. Chorev. 1999. Mapping the integrin alpha vbeta 3-ligand interface by photoaffinity cross-linking. Biochemistry 38:3414-3420[CrossRef][Medline].
14. Blystone, S. D., F. P. Lindberg, S. E. LaFlamme, and E. J. Brown. 1995. Integrin beta 3 cytoplasmic tail is necessary and sufficient for regulation of alpha 5beta 1 phagocytosis by alpha vbeta 3 and integrin-associated protein. J. Cell Biol. 130:745-754[Abstract/Free Full Text].
15. Calvete, J. J., A. Henschen, and J. González-Rodríguez. 1991. Assignment of disulphide bonds in human platelet GPIIIa. A disulphide pattern for the beta -subunits of the integrin family. Biochem. J. 274:63-71.
16. Carrell, N. A., L. A. Fitzgerald, B. Steiner, H. P. Erickson, and D. R. Phillips. 1985. Structure of human platelet membrane glycoproteins IIb and IIIa as determined by electron microscopy. J. Biol. Chem. 260:1743-1749[Abstract/Free Full Text].
17. Cheresh, D. 1987. Human endothelial cells synthesize and express an arg-gly-asp-directed adhesion receptor involved in attachment to fibrinogen and von Willebrand factor. Proc. Natl. Acad. Sci. USA 84:6471-6475[Abstract/Free Full Text].
18. Cieutat, A. M., J. P. Ross, F. Letourneur, M. Poncz, and S. Rifat. 1993. A comparative analysis of cDNA-derived sequences for rat and mouse beta 3 integrins (GPIIIa) with their human counterpart. Biochem. Biophys. Res. Commun. 193:771-778[CrossRef][Medline].
19. D'Souza, S. E., T. A. Haas, R. S. Piotrowicz, V. Byers-Ward, D. E. McGrath, H. R. Soule, C. Cierniewski, E. F. Plow, and J. W. Smith. 1994. Ligand and cation binding are dual functions of a discrete segment of the integrin beta 3 subunit: cation displacement is involved in ligand binding. Cell 79:659-667[CrossRef][Medline].
20. Du, X., M. Gu, J. W. Weise, C. Nagaswami, J. S. Bennett, R. Bowditch, and M. H. Ginsberg. 1993. Long range propagation of conformational changes in integrin alpha IIbbeta 3. J. Biol. Chem. 268:23087-23092[Abstract/Free Full Text].
21. Faull, R. J., J. Wang, D. I. Leavesley, W. Puzon, G. R. Russ, D. Vestweber, and Y. Takada. 1996. A novel activating anti-beta 1 integrin monoclonal antibody binds to the cysteine-rich repeats in the beta 1 chain. J. Biol. Chem. 271:25099-25106[Abstract/Free Full Text].
22. Fernández, C., K. Clark, L. Burrows, N. R. Schofield, and M. J. Humphries. 1998. Regulation of the extracellular ligand binding activity of integrins. Front. Biosci. 3:684-700.
23. Fox, G., N. R. Parry, P. V. Barnett, B. McGinn, D. Rowlands, and F. Brown. 1989. The cell attachment site on foot-and-mouth disease virus includes the amino acid sequence RGD (arginine-glycine-aspartic acid). J. Gen. Virol. 70:625-637[Abstract/Free Full Text].
24. Frachet, P., G. Uzan, D. Thevenon, E. Denarier, M. H. Prandini, and G. Marguerie. 1990. GPIIb and GPIIIa amino acid sequences deduced from human megakaryocyte cDNAs. Mol. Biol. Rep. 14:27-33[CrossRef][Medline].
25. Fry, E. E., S. M. Lea, T. Jackson, J. W. I. Newman, F. M. Ellard, W. E. Blakemore, R. Abu-Ghazaleh, A. Samuel, A. M. Q. King, and D. I. Stuart. 1999. The structure and function of a foot-and-mouth disease virus-oligosaccharide receptor complex. EMBO J. 18:543-554[CrossRef][Medline].
26. Gavrilovskaya, I. N., E. J. Brown, M. H. Ginsberg, and E. R. Mackow. 1999. Cellular entry of hantaviruses which cause hemorrhagic fever with renal syndrome is mediated by beta 3 integrins. J. Virol. 73:3951-3959[Abstract/Free Full Text].
27. Gavrilovskaya, I. N., M. Shepley, R. Shaw, M. H. Ginsberg, and E. R. Mackow. 1998. beta 3 integrins mediate the cellular entry of hantaviruses that cause respiratory failure. Proc. Natl. Acad. Sci. USA 95:7074-7079[Abstract/Free Full Text].
28. Gibson, M. A., D. I. Leavesley, and L. K. Ashman. 1999. Microfibril-associated glycoprotein-2 specifically interacts with a range of bovine and human cell types via the alpha vbeta 3 integrin. J. Biol. Chem. 274:13060-13065[Abstract/Free Full Text].
29. González-Amaro, R., and F. Sánchez-Madrid. 1999. Cell adhesion molecules: selectins and integrins. Crit. Rev. Immunol. 19:389-429[Medline].
30. Green, L., A. P. Mould, and M. J. Humphries. 1998. The integrin beta subunit. Int. J. Biochem. Cell Biol. 30:179-184[CrossRef][Medline].
31. He, Y., V. D. Bowman, S. Mueller, C. M. Bator, J. Bella, X. Peng, T. S. Baker, E. Wimmer, R. J. Kuhn, and M. G. Rossmann. 2000. Interaction of the poliovirus receptor with poliovirus. Proc. Natl. Acad. Sci. USA 97:79-84[Abstract/Free Full Text].
32. Honda, S., Y. Tomiyama, A. J. Pelletier, D. Annis, Y. Honda, R. Orcheskowski, Z. Ruggeri, and T. J. Kunicki. 1995. Topography of ligand-induced binding sites, including a novel cation-sensitive epitope (AP5) at the amino terminus, of the human integrin beta 3 subunit. J. Biol. Chem. 270:11947-11954[Abstract/Free Full Text].
33. Horton, M. A. 1997. The alpha vbeta 3 integrin "vitronectin receptor." Int. J. Biochem. Cell Biol. 29:721-725[CrossRef][Medline].
34. Humphries, M. J. 1999. Towards a structural model of an integrin. Biochem. Soc. Symp. 65:63-78[Medline].
35. Hynes, R. O. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69:11-25[CrossRef][Medline].
36. Jackson, T., F. M. Ellard, R. Abu-Ghazaleh, S. M. Brooks, W. E. Blakemore, A. H. Corteyn, D. I. Stuart, J. W. I. Newman, and A. M. Q. King. 1996. Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulfate. J. Virol. 70:5282-5287[Abstract/Free Full Text].
37. Kashiwagi, H., Y. Tomiyama, S. Tadokoro, S. Honda, M. Shiraga, H. Mizutani, M. Handa, Y. Kurata, Y. Matsuzawa, and S. J. Shattil. 1999. A mutation in the extracellular cysteine-rich repeat region of the beta 3 subunit activates integrins alpha IIbbeta 3 and alpha vbeta 3. Blood 93:2559-2568[Abstract/Free Full Text].
38. Kottler, M. L., R. Counis, and H. Degrelle. 1989. Sex steroid-binding protein: identification and comparison of the primary product following cell-free translation of human monkey (Macaca fascicularis) liver RNA. J. Steroid Biochem. 33:201-207[CrossRef][Medline].
39. Lin, E. C. K., B. I. Ratnikov, P. M. Tsai, C. P. Carron, D. M. Meyers, C. F. Barbas III, and J. W. Smith. 1997. Identification of a region in the integrin beta 3 subunit that confers ligand binding specificity. J. Biol. Chem. 272:23912-23920[Abstract/Free Full Text].
40. Lindberg, F. P., H. D. Gresham, E. Schwarz, and E. J. Brown. 1993. Molecular cloning of integrin-associated protein: an immunoglobulin family member with multiple membrane-spanning domains implicated in alpha vbeta 3-dependent ligand binding. J. Cell Biol. 123:485-496[Abstract/Free Full Text].
41. Loftus, J. C., C. E. Halloran, M. H. Ginsberg, L. P. Feigen, J. A. Zablock, and J. W. Smith. 1996. The amino-terminal one-third of alpha IIb defines the ligand recognition specificity of integrin alpha IIbbeta 3. J. Biol. Chem. 271:2033-2039[Abstract/Free Full Text].
42. Logan, D., R. Abu-Ghazaleh, W. Blakemore, S. Curry, T. Jackson, A. King, S. Lea, R. Lewis, J. Newman, N. Parry, D. Rowlands, D. Stuart, and E. Fry. 1993. Structure of a major immunogenic site on foot-and-mouth disease virus. Nature 362:566-568[CrossRef][Medline].
43. Martínez, M., N. Verdaguer, M. G. Mateu, and E. Domingo. 1997. Evolution subverting essentiality: dispensability of the cell attachment arg-gly-asp motif in multiply passaged foot-and-mouth disease virus. Proc. Natl. Acad. Sci. USA 94:6798-6802[Abstract/Free Full Text].
44. Mason, P. W., B. Baxt, F. Brown, J. Harber, A. Murdin, and E. Wimmer. 1993. Antibody-complexed foot-and-mouth disease, but not poliovirus, can infect normally insusceptible cells via the Fc receptor. Virology 192:568-577[CrossRef][Medline].
45. Mason, P. W., E. Rieder, and B. Baxt. 1994. RGD sequence of foot-and-mouth disease virus is essential for infecting cells via the natural receptor but can be bypassed by an antibody-dependent enhancement mechanism. Proc. Natl. Acad. Sci. USA 91:1932-1936[Abstract/Free Full Text].
46. Morrison, M. E., and V. R. Racaniello. 1992. Molecular cloning and expression of a murine homolog of the human poliovirus receptor gene. J. Virol. 66:2807-2813[Abstract/Free Full Text].
47. Neff, S., Sá- Carvalho, E. Rieder, P. W. Mason, S. D. Blystone, E. J. Brown, and B. Baxt. 1998. Foot-and-mouth disease virus virulent for cattle utilizes the integrin alpha vbeta 3 as its receptor. J. Virol. 72:3587-3594[Abstract/Free Full Text].
48. Nelsen-Salz, B., H. J. Eggers, and H. Zimmermann. 1999. Integrin alpha vbeta 3 (vitronectin receptor) is a candidate receptor for the virulent echovirus 9 strain Barty. J. Gen. Virol. 80:2311-2313[Abstract/Free Full Text].
49. Nermut, M. V., N. M. Green, P. Eason, S. S. Yamada, and K. M. Yamada. 1988. Electron microscopy and structural model of human fibronectin receptor. EMBO J. 7:4093-4099[Medline].
50. Pulli, T., E. Koivunen, and T. Hyypiä. 1997. Cell-surface interactions of echovirus 22. J. Biol. Chem. 272:21176-21180[Abstract/Free Full Text].
51. Rieder, E., B. Baxt, and P. W. Mason. 1994. Animal-derived antigenic variants of foot-and-mouth disease virus type A12 have low affinity for cells in culture. J. Virol. 68:5296-5299[Abstract/Free Full Text].
52. Rieder, E., T. Bunch, F. Brown, and P. W. Mason. 1993. Genetically engineered foot-and-mouth disease viruses with poly(C) tracts of two nucleotides are virulent in mice. J. Virol. 67:5139-5145[Abstract/Free Full Text].
53. Roivainen, M., L. Piiraninen, T. Hovi, I. Virtanen, T. Rikonen, J. Heino, and T. Hyypiä. 1994. Entry of coxsackievirus A9 into host cells: specific interaction with alpha vbeta 3 integrin, the vitronectin receptor. Virology 203:357-365[CrossRef][Medline].
54. Sá-Carvalho, D., E. Rieder, B. Baxt, R. Rodarte, A. Tanuri, and P. W. Mason. 1997. Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. J. Virol. 71:5115-5123[Abstract].
55. Schneider, G. B., S. W. Whitson, and L. F. Cooper. 1999. Restricted and coordinated expression of beta 3-integrin and bone sialoprotein during cultured osteoblast differentiation. Bone 24:321-327[Medline].
56. Smith, J. W., and D. A. Cherish. 1988. The arg-gly-asp binding domain of the vitronectin receptor. Photoaffinity cross-linking implicates amino acid residues 61-203 of the beta  subunit. J. Biol. Chem. 263:18726-18731[Abstract/Free Full Text].
57. Smith, J. W., and D. A. Cheresh. 1990. Integrin (alpha vbeta 3)-ligand interaction. Identification of a heterodimeric RGD binding site on the vitronectin receptor. J. Biol. Chem. 265:2168-2172[Abstract/Free Full Text].
58. Starr, C. M., and J. A. Hanover. 1990. Glycosylation of nuclear pore protein p62. Reticulocyte lysate catalyzes O-linked N-acetylglucosamine addition in vitro. J. Biol. Chem. 265:6868-6873[Abstract/Free Full Text].
59. Stave, J. W., J. L. Card, D. O. Morgan, and V. N. Vakharia. 1988. Neutralization sites of type O1 foot-and-mouth disease virus defined by monoclonal antibodies and neutralization-escape virus variants. Virology 161:21-29.
60. Suzuki, S., W. S. Argraves, H. Arai, L. R. Languino, M. D. Pierschbacher, and E. Ruoslahti. 1987. Amino acid sequence of the vitronectin receptor alpha  subunit and comparative expression of the adhesion receptor mRNAs. J. Biol. Chem. 262:14080-14085[Abstract/Free Full Text].
61. Takagi, J., T. Kamata, J. Meredith, W. Puzon-McLaughlin, and Y. Takada. 1997. Changing ligand specificities of alpha vbeta 1 and alpha vbeta 3 integrins by swapping a short diverse sequence of the beta  subunit. J. Biol. Chem. 272:19794-19800[Abstract/Free Full Text].
62. Tozer, E. C., R. C. Liddington, M. J. Sutcliffe, A. H. Smeeton, and J. C. Loftus. 1996. Ligand binding to integrin alpha IIbbeta 3 is dependent on a MIDAS-like domain in the beta 3 subunit. J. Biol. Chem. 271:21978-21984[Abstract/Free Full Text].
63. Wada, J., A. Kumar, Z. Liu, E. Ruoslahti, L. Reichardt, J. Marvaldi, and Y. S. Kanwar. 1996. Cloning of mouse integrin alpha v cDNA and role of the alpha v related matrix receptors in metanephric development. J. Cell Biol. 132:1161-1176[Abstract/Free Full Text].
64. Wickham, T. J., P. Mathias, D. A. Cheresh, and G. R. Nemerow. 1993. Integrins alpha vbeta 3 and alpha vbeta 5 promote adenovirus internalization but not virus attachment. Cell 73:309-319[CrossRef][Medline].
65. Zimrin, A. B., R. Eisman, G. Vilaire, E. Schwartz, J. S. Bennett, and M. Poncz. 1988. Structure of platelet glycoprotein IIIa. A common subunit for two different membrane receptors. J. Clin. Investig. 81:470-475.


Journal of Virology, August 2000, p. 7298-7306, Vol. 74, No. 16
0022-538X/00/$04.00+0



This article has been cited by other articles:

  • Piccone, M. E., Feng, Y., Chang, A. C. Y., Mosseri, R., Lu, Q., Kutish, G. F., Lu, Z., Burrage, T. G., Gooch, C., Rock, D. L., Cohen, S. N. (2009). Identification of Cellular Genes Affecting the Infectivity of Foot-and-Mouth Disease Virus. J. Virol. 83: 6681-6688 [Abstract] [Full Text]  
  • Gutierrez-Rivas, M., Pulido, M. R., Baranowski, E., Sobrino, F., Saiz, M. (2008). Tolerance to mutations in the foot-and-mouth disease virus integrin-binding RGD region is different in cultured cells and in vivo and depends on the capsid sequence context. J. Gen. Virol. 89: 2531-2539 [Abstract] [Full Text]  
  • Rieder, E., Henry, T., Duque, H., Baxt, B. (2005). Analysis of a Foot-and-Mouth Disease Virus Type A24 Isolate Containing an SGD Receptor Recognition Site In Vitro and Its Pathogenesis in Cattle. J. Virol. 79: 12989-12998 [Abstract] [Full Text]  
  • O'Donnell, V., LaRocco, M., Duque, H., Baxt, B. (2005). Analysis of Foot-and-Mouth Disease Virus Internalization Events in Cultured Cells. J. Virol. 79: 8506-8518 [Abstract] [Full Text]  
  • Monaghan, P., Simpson, J., Murphy, C., Durand, S., Quan, M., Alexandersen, S. (2005). Use of Confocal Immunofluorescence Microscopy To Localize Viral Nonstructural Proteins and Potential Sites of Replication in Pigs Experimentally Infected with Foot-and-Mouth Disease Virus. J. Virol. 79: 6410-6418 [Abstract] [Full Text]  
  • Duque, H., LaRocco, M., Golde, W. T., Baxt, B. (2004). Interactions of Foot-and-Mouth Disease Virus with Soluble Bovine {alpha}V{beta}3 and {alpha}V{beta}6 Integrins. J. Virol. 78: 9773-9781 [Abstract] [Full Text]  
  • Williams, C. H., Kajander, T., Hyypia, T., Jackson, T., Sheppard, D., Stanway, G. (2004). Integrin {alpha}v{beta}6 Is an RGD-Dependent Receptor for Coxsackievirus A9. J. Virol. 78: 6967-6973 [Abstract] [Full Text]  
  • Grubman, M. J., Baxt, B. (2004). Foot-and-Mouth Disease. Clin. Microbiol. Rev. 17: 465-493 [Abstract] [Full Text]  
  • Zhao, Q., Pacheco, J. M., Mason, P. W. (2003). Evaluation of Genetically Engineered Derivatives of a Chinese Strain of Foot-and-Mouth Disease Virus Reveals a Novel Cell-Binding Site Which Functions in Cell Culture and in Animals. J. Virol. 77: 3269-3280 [Abstract] [Full Text]  
  • Duque, H., Baxt, B. (2003). Foot-and-Mouth Disease Virus Receptors: Comparison of Bovine {alpha}V Integrin Utilization by Type A and O Viruses. J. Virol. 77: 2500-2511 [Abstract] [Full Text]  
  • Boonyakiat, Y., Hughes, P. J., Ghazi, F., Stanway, G. (2001). Arginine-Glycine-Aspartic Acid Motif Is Critical for Human Parechovirus 1 Entry. J. Virol. 75: 10000-10004 [Abstract] [Full Text]  
  • Leippert, M., Pfaff, E. (2001). Foot-and-mouth disease virus can utilize the C-terminal extension of coxsackievirus A9 VP1 for cell infection. J. Gen. Virol. 82: 1703-1711 [Abstract] [Full Text]  
  • Neff, S., Baxt, B. (2001). The Ability of Integrin {alpha}v{beta}3 To Function as a Receptor for Foot-and-Mouth Disease Virus Is Not Dependent on the Presence of Complete Subunit Cytoplasmic Domains. J. Virol. 75: 527-532 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neff, S.
Right arrow Articles by Baxt, B.