Previous Article | Next Article ![]()
Journal of Virology, August 2000, p. 7298-7306, Vol. 74, No. 16
Foot-and-Mouth Disease Research Unit, USDA
Agricultural Research Service, Plum Island Animal Disease Center,
Greenport, New York 11944
Received 6 March 2000/Accepted 19 May 2000
We have previously reported that Foot-and-mouth disease
virus (FMDV), which is virulent for cattle and swine, can utilize the integrin Foot-and-mouth disease
virus (FMDV), an Aphthovirus in the
Picornaviridae family, is the cause of foot-and-mouth
disease, a highly infectious disease of domestic livestock. The virus
initiates infection by binding to its cellular receptor via an
arginine-glycine-aspartic acid (RGD) sequence found within a surface
protrusion consisting of the loop between the Integrins are heterodimeric molecules, consisting of The While previous studies have shown that FMDV can utilize the human
(47) and simian (11) homologs of the
cDNA cloning.
Single-stranded cDNA was reverse transcribed
from bovine lung poly(A)+ RNA (Clontech) using Superscript
II reverse transcriptase (Life Technologies) and an
oligo(dT)18 primer. The bovine
0022-538X/00/$04.00+0
High-Efficiency Utilization of the Bovine Integrin
v
3 as a Receptor for Foot-and-Mouth
Disease Virus Is Dependent on the Bovine
3
Subunit
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
v
3 as a receptor on cultured
cells. Since those studies were performed with the human integrin, we
have molecularly cloned the bovine homolog of the integrin
v
3 and have compared the two receptors
for utilization by FMDV. Both the
v and
3 subunits of the bovine integrin have high degrees of amino acid sequence similarity to their corresponding human subunits in the ectodomains (96%) and essentially identical transmembrane and cytoplasmic domains. Within the putative ligand-binding domains, the
bovine and human
v subunits have a 98.8% amino acid
sequence similarity while there is only a 93% similarity between the
3 subunits of these two species. COS cell cultures,
which are not susceptible to FMDV infection, become susceptible if
cotransfected with
v and
3 subunit cDNAs
from a bovine or human source. Cultures cotransfected with the bovine
v
3 subunit cDNAs and infected with FMDV
synthesize greater amounts of viral proteins than do infected cultures
cotransfected with the human integrin subunits. Cells cotransfected
with a bovine
v subunit and a human
3
subunit synthesize viral proteins at levels equivalent to those in
cells expressing both human subunits. However, cells cotransfected with the human
v and the bovine
3 subunits
synthesize amounts of viral proteins equivalent to those in cells
expressing both bovine subunits, indicating that the bovine
3 subunit is responsible for the increased effectiveness
of this receptor. By engineering chimeric bovine-human
3
subunits, we have shown that this increase in receptor efficiency is
due to sequences encoding the C-terminal one-third of the subunit
ectodomain, which contains a highly structured cysteine-rich repeat
region. We postulate that amino acid sequence differences within this
region may be responsible for structural differences between the human
and bovine
3 subunit, leading to more efficient
utilization of the bovine receptor by this bovine pathogen.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
G and
H strands
(G-H loop) of the capsid protein VP1 (1, 6, 23, 42, 45).
While FMDV can utilize other receptors on cultured cells, such as the
Fc receptor (7, 44) or heparan sulfate (3, 25, 36,
47), these receptors do not require the RGD sequence (43,
47). We have demonstrated that antibodies to the integrin
receptor
v
3 can inhibit adsorption and
plaque formation by FMDV (11). Furthermore, we have also shown that the virus, which is virulent for cattle, can infect only
cells expressing this integrin receptor and that site-directed mutants
of these viruses lacking an RGD sequence are not capable of infecting
cells expressing
v
3 (45, 47).
and
subunits which interact noncovalently at the cell surface and have a
wide species distribution (35). They are involved in extracellular matrix and cell-cell interactions and also serve as
signal-transducing receptors (29). A total of 16
and 8
subunits have been described, giving rise to 22 different
integrins, each with its own ligand-binding specificity, and 7 of
which, including
v
3, bind to their
natural ligands via an RGD sequence (22, 35). Electron
microscopic visualization of integrins reveals a globular structure,
presumably the ligand-binding region combining elements of both
subunits with two stalk-like structures extending to the cell surface
(16, 49).
v
3 integrin is one of two receptors
within the class of integrins called cytoadhesins (29). The
3 subunit is found only complexed with one other
subunit,
IIb, while the
v subunit can
complex with four additional
subunits (
1,
5,
6, and
8) (35). Although
v
3 was
originally called the vitronectin receptor, it can bind to other
ligands (33). While it is clear that both the
and
subunits of integrins structurally contribute to ligand binding
(22, 34), there are specific regions of the
v
(41, 57) and
3 (13, 19, 39, 56, 61,
62) subunits that have been identified as directly interacting
with ligands. At least two other picornaviruses can utilize
v
3 to initiate infection, coxsackievirus
A9 (CAV9) (53) and echovirus 9 (48). In addition, human adenovirus utilizes integrins
v
3
and
v
5 to facilitate internalization
(64); two hantaviruses, which cause different human disease
syndromes, utilize
v
3 and
IIb
3 to mediate cellular entry (26,
27); and human parechovirus 1 (formerly echovirus 22) may utilize
the
v
1 integrin as a receptor
(50).
v
3 integrin to infect cells, this virus
does not cause disease in humans (4). Therefore, we have
characterized the bovine homolog of this integrin to determine how it
interacts with this bovine pathogen. These studies demonstrate that
FMDV utilizes the bovine integrin with much greater efficiency than it
utilizes the human integrin, and we show that this increased efficiency
is due to bovine sequences located within the C-terminal one-third of
the
3 subunit ectodomain.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
v cDNA was generated in two pieces by a 30-cycle PCR using Taq
polymerase (Boehringer Mannheim) and the following sets of primers,
which introduce a silent mutation creating a BamHI
restriction endonuclease site that could be used to recreate complete
v coding sequences: 5'CGCGCACCCCGGCGATGGCT3'
plus 5'CCATCGGATCCGCGATCCATG3', and
5'GGATCCGATGGCAAACTCCAGGAG3' plus
5'GGAATTCCTTAAGTTTCTGAGTTTCCTTCACC 3'. The resulting PCR products were ligated into the vector pCR2.1 (Invitrogen) and sequenced. Plasmid DNA containing the 3' piece of bovine
v cDNA was ligated to the 5' bovine
v
cDNA utilizing this synthetic BamHI site. The resulting
full-length
v cDNA fragment was inserted into the vector
pcDNA3.1/Zeo(
) (Invitrogen) to create pBov
vZEO.
3 subunit was
generated by a 30-cycle PCR using Advantage KlenTaq polymerase mix
(Clontech) and the following primers, which introduce a silent mutation
creating an MluI site following the predicted N-terminal
signal peptide cleavage site: 5'CCACGCGTGGTGTGAGCTCCTG3'
plus 5'GGATCCTAAGGCCCCGGTACGTGATATTG3'. To generate a
signal peptide sequence for use with the bovine
3 coding
region, human
3 cDNA (
3/pIAP58) (14,
40, 47) was used as a template for 15 cycles of PCR amplification
with Advantage KlenTaq polymerase mix and the following primers, which also introduce a silent mutation creating an MluI site in
frame with the bovine open reading frame: 5'CAGATGCGAGCGCGGCCGC3'
plus 5'CGGGATCCTTAAGTGCCCCGGTACGTGATATTG3'. The PCR
products were inserted into the pCR-Blunt II-TOPO vector (Invitrogen)
and sequenced. The cDNA encoding mature bovine
3 was
ligated to the human signal peptide sequence and inserted into
pcDNA3.1/Zeo(
) to create pBov
3ZEO. The human
v-encoding plasmid, pHum
vZEO, has been
described previously (47). The human
3-encoding plasmid,
3/pIAP58 (14,
40, 47), was inserted into pcDNA3.1/Zeo(
) to generate
pHum
3ZEO.
Generation of chimeric
3 subunits.
Chimeric
cDNAs for the
3 integrin were created using a
KpnI site shared by pBov
3ZEO and
pHum
3ZEO at codon 136. Plasmid phkb
3
contained the first 136 codons of the human
3 subunit and the remaining codons from the bovine
3 subunit.
Plasmid pbkh
3 was the inverse chimera and contained
bovine sequences to codon 136 and human sequences for the remainder of
the subunit. The chimeric cDNAs phsb
3 and
pbsh
3 were created using a similar strategy and a
SmaI site at codon 488 of pBov
3ZEO and
pHum
3ZEO. The resulting constructs were sequenced around
the restriction sites to ensure their identity.
Sequencing.
Automated sequencing was performed on an Applied
Biosystems 370A sequencer with an XL upgrade, using the ABI Prism Big
Dye terminator cycle-sequencing ready reaction kit (Perkin-Elmer) as
described by the manufacturer. Sequence analysis was done using the
Lasergene analysis software package (DNASTAR Inc.). The nucleotide sequences for the human
v and
3 subunits
were from GenBank (accession numbers M14648 [60] and
M35999 [24], respectively).
Coupled in vitro transcription-translation. Plasmid DNA (1 µg) was used in either a wheat germ extract or rabbit reticulocyte lysate TNT Quick coupled transcription-translation system (Promega) in the presence of [35S]methionine (Amersham) as described by the manufacturer. The resulting protein products were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 7.5% gel.
Viruses and cells. FMDV type A12, strain 119ab, was derived from the infectious cDNA clone pRMC35 (52). An antigenic variant of type A12, harboring the VP1 sequence present in a bovine tongue tissue-propagated type A12 (vRM-SSP), has been described previously (51). The cattle-virulent variant derived from infectious cDNA containing capsid sequences isolated from a vaccine seed stock of type O1Campos (vCRM8) has also been described previously (54). COS-1 cells were maintained on Dulbecco's minimal essential medium (Life Technologies Inc.) containing 10% calf serum, an additional 2 mM L-glutamine, 1 mM sodium pyruvate, 10 U of penicillin G per ml, 10 U of streptomycin sulfate per ml, and 0.25 µg of amphotericin B per ml.
Transient expression of integrin subunits in COS-1 cells. Cells were plated at a density of 105 cells/well on six-well tissue culture dishes the day before transfection. Transfections were performed using 2.0 µg of each integrin-encoding plasmid mixed with the transfection reagent FuGENE 6 (Roche Molecular Biochemicals) as specified by the manufacturer. After incubation at 37°C overnight, the cells were trypsinized and replated onto 2 wells of a 24-well tissue culture dish. After an additional overnight incubation at 37°C, cells in one well of each transfected condition were infected with FMDV and cells in the other well were analyzed for integrin expression by immunohistochemistry (IHC).
Immunohistochemistry.
Transfected cells were fixed on ice
for 5 min with acetone-methanol (50:50). Fixed cells were rehydrated
with minimal essential medium containing 0.2% bovine serum albumin, 50 mM HEPES (pH 7.5), and 1% normal horse serum. The cells were reacted
with a 1:500 dilution of the anti-
v
3
monoclonal antibody (MAb) LM609 (MAB1976; Chemicon International Inc.)
(17) for 30 min at 37°C. Primary-antibody binding was
detected using an alkaline phosphatase avidin-biotin system and
biotinylated horse anti-mouse immunoglobulin G (Vectastain Elite ABC
kit; Vector Laboratories). Bound phosphatase was visualized using the
Vector VIP substrate kit (Vector Laboratories).
Viral replication assays. Transfected and nontransfected COS-1 cells were infected and analyzed as previously described (47). Briefly, cells were infected with various FMDV serotypes at a multiplicity of infection (MOI) of 10 PFU/cell and labeled overnight, beginning at 4 h after infection, with 50 to 75 µCi of [35S]methionine at 37°C. Cell lysates were prepared in 1% Triton X-100, trichloroacetic acid (TCA)-precipitable counts per minute (cpm) were determined, and radioimmunoprecipitation (RIP) was preformed as previously described (5) using anti-FMDV type A12 MAb 6EE2 (8) for type A12- and vRM-SSP-infected cells and anti-FMDV type O1 MAb 10GA4 (59) for vCRM8-infected cultures. Equal amounts of TCA-precipitable CPM were immunoprecipitated and analyzed by SDS-PAGE using a 10% polyacrylamide gel.
Nucleotide sequence accession numbers.
Nucleotide sequences
for the bovine
v and
3 cDNAs have been
submitted to GenBank and have been assigned accession numbers AF239958
and AF239959, respectively.
| |
RESULTS |
|---|
|
|
|---|
cDNA cloning of the bovine integrin
v
3 subunits.
The identification of
v
3 as the receptor for virulent forms of
FMDV (47) utilizing human
v
3
cDNAs led us to examine the available integrin subunit sequences.
Interspecies comparisons for both the
v (63)
and
3 (18) subunits have shown that there are
differences in the deduced amino acid sequences among the species
sequenced to date. For this reason, we thought it important to obtain
cDNAs encoding
v
3 from a species that is naturally susceptible to FMDV infection, such as cattle. PCR with cDNA
from bovine lung tissue and primers based on known human and mouse
integrin sequences (18, 60, 63, 65) generated fragments of
the expected sizes for both the
v and
3
subunits. These fragments were ligated and inserted into expression
vectors that would allow in vitro transcription-translation analysis
and eukaryotic expression. The complete coding sequence for the bovine
v subunit cDNA was 3,144 bp coding for a 1,048-amino
acid protein. The encoded protein consists of a 30-residue signal
peptide, a 963-residue extracellular ectodomain, a 23-residue
transmembrane domain, and a 32-residue cytoplasmic domain. The complete
coding sequence for the bovine
3 subunit cDNA was 2,364 bp coding for a 788-amino-acid protein. Since we were unable to
generate a fragment which included the authentic bovine
3 signal peptide sequence, we removed the coding region
for this peptide from the human
3 cDNA plasmid and
ligated it to the remainder of the bovine
3 cDNA as
described in Materials and Methods. Thus, the encoded protein consists
of the 26-residue human signal peptide, a 692-residue extracellular
ectodomain, a 23-residue transmembrane domain, and a 47-residue
cytoplasmic domain.
v and
3 subunits to determine if the
bovine constructs were capable of generating proteins in the same size
range as the human subunits. Radiolabeled protein was generated and
separated by SDS-PAGE (7.5% polyacrylamide) as described in Materials
and Methods. Transcription-translation of the bovine
v
subunit in a rabbit reticulocyte lysate translation system generated a
product that was comparable in size, based on migration in a denaturing gel, to the human
v subunit (Fig.
1a). In contrast, in the rabbit reticulocyte lysate system, the bovine
3 subunit
migrated faster, to an apparent lower molecular weight than the human
subunit did (Fig. 1a). Since differences in glycosylation may account
for differences in migration on SDS-PAGE, the transcription-translation reactions were repeated utilizing a wheat germ extract. In contrast to
the result seen in the rabbit reticulocyte lysate, the bovine and human
3 subunits synthesized in this system were comparable in
size, as were the
v subunits (Fig. 1b). While O-linked
glycosylation occurs in rabbit reticulocyte lysates in the absence of
microsomal membranes, this posttranslational modification cannot take
place in wheat germ extracts in the absence of membranes. In contrast, N-linked glycosylation occurs only in the presence of microsomal membranes in either extract (38, 58). Since we did not add microsomal membranes to either lysate, differences seen between the
bovine and human
3 subunits in the rabbit reticulocyte
lysate may have been due to differences in glycosylation. Examination of potential O-linked glycosylation sites in the
3
subunits revealed differences between human and bovine
3
subunits which may account for the variation in apparent molecular
weight seen in the rabbit reticulocyte lysate system (results not
shown).
|
Sequence comparisons of bovine and human integrin subunits.
The cloned bovine subunit cDNAs were sequenced using automated
sequencing, as described in Materials and Methods, and compared with the reported human
v and
3 subunit
sequences (24, 60). Analysis of the two bovine subunit
constructs revealed a high degree of sequence similarity to their
counterpart human homolog subunits. Alignment of DNA sequence
using the Martinez/Needlemen-Wunsch alignment method, with a
gap penalty of 1.10 and a gap length penalty of 0.33, showed that the
sequence similarities between the bovine and human
v and
3 extracellular ectodomains were 93.6 and 90.1%,
respectively (Table 1). When the deduced
amino acid sequences within this region were compared by Lipman-Pearson alignment (gap penalty of 4 and gap length penalty of 12), the sequence
similarity was about 96% for both subunits (Table 1). The
transmembrane and cytoplasmic domains of both bovine subunits displayed
the highest level of amino acid similarity to their human homologs: the
v subunits were identical in this domain, and the
3 subunits had a 99.9% similarity even though the
nucleotide sequence similarity was rather low at 88% (Table 1). We
also compared sequences which lie within the putative ligand-binding domains of these subunits. The ligand-binding domains of the human
v and
3 subunits have been determined
using a number of methods, most prominently photoaffinity
cross-linking and generation of chimeric receptors with closely related
v and
3 subunits. These studies have
estimated that the ligand-binding regions for the
v and
3 subunits lie between amino acid residues 1 and 340 (41, 57) and between residues 85 and 207 (13, 19, 39,
56, 61, 62), respectively (amino acid residue 1 is the first
amino acid after cleavage of the signal sequence). Within this domain, the amino acid sequence similarity between bovine and human
sequences was quite high for the
v subunit (98.8%) but
was only 93.5% for the
3 subunit.
|
Transient expression of integrin subunits in COS-1 cells.
Cells were cotransfected with each integrin subunit using FuGENE 6 as
described in Materials and Methods. The cells were grown for 48 h,
fixed, and immunostained using the
anti-
v
3 MAb LM609. Figure
2 shows that cells expressing either
bovine or human
v
3 were stained equally
well with this MAb, which reacts only with the heterodimeric
v
3 integrin (17). This
confirms previously reported results showing that LM609, which was
generated against the human integrin, also reacts with the complete
bovine integrin (12, 28, 55). Furthermore, these results
indicate that both integrins were expressed to approximately comparable
levels in the COS-1 cells. We also examined the expression of the
v
3 integrin in cells transfected with
mixed bovine-human subunits. The results in Fig. 2 show that these
cultures also expressed the integrin to levels comparable to those seen
in either complete bovine or complete human integrin expression.
Because integrins can be composed of different combinations of
and
subunits (35), transfections were also done with the
individual subunits and cells were analyzed by IHC. In all cases, no
staining above the level seen in the control cells was observed (data
not shown), indicating that the staining obtained in cells transfected
with both subunits was not due to the formation of heterodimers between
the transfected subunits and endogenous monkey integrin subunits.
|
Replication of FMDV in integrin subunit-transfected cells.
COS-1 cells were transfected with complete bovine or human
integrin subunit cDNAs or with mixed bovine-human subunits and infected with FMDV as outlined in Materials and Methods. We used three
different viruses for these studies: our tissue culture-adapted type A12, an A12 variant containing sequences
isolated from the tongue of an infected bovine (vRM-SSP)
(51), and a highly cattle-virulent variant of type
O1Campos (vCRM8) (54). These viruses
utilize only
v
3 as a receptor to infect
cultured cells (47). Transfected-infected cells were labeled
overnight with [35S]methionine, and lysates were analyzed
by RIP and SDS-PAGE as described in Materials and Methods. In all of
these assays, equal numbers of TCA-precipitable cpm and equal amounts
of protein were immunoprecipitated within each experiment. This
normalized the various conditions and allowed us to make
semiquantitative comparisons of the levels of viral protein synthesis.
The results in Fig. 3 show the presence
of viral proteins only in infected cells expressing either bovine or
human
v
3, confirming our previous
findings obtained in experiments with human integrin-transfected cells (47).
|
3 was expressed, regardless of which
v subunit was transfected. In fact, expression of the
bovine
3 subunit along with the human
v
subunit resulted in a level of viral protein synthesis comparable to
that seen with the complete bovine integrin. The differences in the
level of viral protein synthesis appeared to be more pronounced when
the cells were infected with the laboratory strain A12
virus than when they were infected with either of the other two
animal-derived viruses. However, it is clear in all cases that viral
replication, as measured in this assay, was greater when the bovine
v
3 integrin was used as a receptor. In
nontransfected COS-1 cells, there was a very low level of viral protein
synthesis in cells infected with the vCRM8 virus (Fig. 3). We are not
sure why this occurred; however, it may be the result of a low
level of virus which utilizes cell surface heparan sulfate as a
receptor (47, 54), either present in the original seed or
generated during the overnight incubation.
FMDV infection in cells expressing chimeric bovine-human
3 subunit receptors.
Since the results presented in
the previous section indicated that the bovine
3 subunit
was necessary for the higher level of viral protein synthesis seen in
transfected-infected cells, we generated chimeric bovine-human
3 subunits to delineate which portions of the subunit
were responsible for this phenomenon. To do this, we took advantage of
two unique restriction sites that are conserved in both the bovine and
human
3 cDNAs. A schematic diagram for the chimeric
3 subunits is shown in Fig.
4a. The first two were created using a
KpnI restriction site, which facilitated a reciprocal swap
within the ligand-binding domain at amino acid residue 136. These swaps
generated the proteins hkb
3, which contains human
sequences from the N terminus to codon 136 and bovine sequences for the
rest of the subunit, and bkh
3, which contains bovine sequences from the N terminus to codon 136 and human sequences for the
rest of the subunit. The second set of chimeric
3
subunits were created using a SmaI restriction site, which
allowed a reciprocal swap within the C-terminal one-third of the
ectodomain at amino acid residue 488, far outside the ligand-binding
domain. These swaps generated the proteins hsb
3, which
contains human sequences from the N terminus to codon 488 and bovine
sequences for the rest of the subunit, and bsh
3, which
contains bovine sequences from the N terminus to codon 488 and human
sequences for the rest of the subunit.
|
3 subunit were
cotransfected into COS-1 cells, along with the human or bovine
v subunit. The resulting cultures were checked for
v
3 expression level by IHC, infected with
FMDV type A12, labeled overnight, and analyzed by RIP and
SDS-PAGE. The results of transfections with the intact bovine and human
3 subunits confirmed the importance of the bovine
3 subunit in increased receptor utilization (Fig. 4b).
The results of transfections with the chimeric
3
subunits showed that the hkb
3 or hsb
3
chimeras supported replication to the same level as the intact bovine
3 did. Interestingly, these results suggest that the
presence of bovine or human sequences from the N terminus of the
3 subunit to amino acid residue 488, including the
ligand-binding domain, did not influence the level of viral protein
synthesis observed. In contrast, the higher levels of viral protein
synthesis were observed only when the
3 subunit
contained bovine sequences downstream from codon 488 (hkb
3 and hsb
3). To rule out any
influence of the bovine
v subunit, we repeated the
experiment using the human
v subunit and obtained
similar results to those seen in Fig. 4b (data not shown).
Sequence comparison within the C-terminal region of the
3 subunit ectodomain.
The
3 subunit
has a high cysteine content, as do all integrin
subunits
(15). The bovine subunit contains 54 cysteine residues, 30 of which are located within a region of four tandem amino acid repeats
near the C terminus of the ectodomain. This is within the region
downstream from amino acid residue 488, which appears to be responsible
for the observed increase in viral protein synthesis. A comparison of
the amino acid sequences of the bovine and human
3
subunits in this region is shown in Fig.
5. The vertical arrow at amino acid
residue 488 represents the location of the SmaI restriction
endonuclease site, and the horizontal arrows show the four tandem
repeats. It can be seen that downstream from residue 488 there are only
seven amino acid residues which differ between the bovine and human
subunits. However, all of the cysteines are conserved, as they are in
the entire subunit, with the exception of one, at residue 503, within
the second repeat region, which is an arginine in the bovine integrin.
The significance of changes within this region on the ability of the
subunit to function as a viral receptor is examined in Discussion.
|
| |
DISCUSSION |
|---|
|
|
|---|
Previous results have implicated integrin
v
3 as a receptor for FMDV by
demonstrating inhibition of infection using integrin-specific antibodies (11) and by demonstrating that cells transfected with cloned human integrin subunit cDNAs became susceptible to infection by FMDV (47). Since these studies were performed
with cDNAs encoding integrin subunits from a host that is not
susceptible to foot-and-mouth disease (see Introduction), we have
repeated these studies with molecularly cloned bovine
v
and
3 cDNAs. The results of these studies indicate that
FMDV was able to utilize the bovine integrin more efficiently than
it utilized the human homolog, and this increased efficiency appears to
correlate with the presence of the bovine
3 subunit.
We have utilized transient expression of
v and
3 subunits of bovine and human origin in COS-1 cells to
examine receptor utilization by FMDV. Using this system, we have
examined the replication of our laboratory strain of FMDV (type
A12), its bovine tongue-derived variant, vRM-SSP
(51), and the highly cattle-virulent type
O1Campos variant, vCRM8 (54), which all utilize
only the integrin
v
3 as receptor
(47). These experiments showed that for these three viruses,
the cotransfection of cells with a bovine
3 subunit and
either a bovine or human
v subunit resulted in the
expression of a more efficiently utilized receptor than did the
cotransfection of cells with both human subunits or bovine
v and human
3 subunits.
To determine the regions of the bovine
3 subunit that
might be responsible for the increased efficiency of use as an FMDV receptor, we generated chimeric bovine-human
3
subunit cDNAs and tested their efficiency as receptors for type
A12 FMDV. The results of these studies indicated that
bovine sequences downstream from codon 488, outside of the
putative ligand-binding domain, appeared to be responsible for the
increased efficiency of the bovine receptor (see Results) (Fig. 4).
Comparison of the amino acid sequences of the bovine and human
3 subunit between codon 488 and the C terminus of the
subunit reveals virtually identical transmembrane and cytoplasmic
domains, with only seven amino acid changes in the ectodomain (Fig. 5). This region of the subunit is rich in cysteines which contribute to the
overall structure of the integrin through disulfide bonding (15). In the mature bovine
3 subunit, 7% of
the amino acids are cysteines (a total of 54 cysteine residues). Thirty
of these cysteine residues are within a region of four tandem repeats
within the integrin stalk region, known as the cysteine-rich repeats (15, 30, 33, 35). A cysteine residue just upstream of the
first cysteine-rich repeat region, at codon 435, forms a disulfide bond
with a cysteine near the N terminus, at codon 5, and probably contributes to the formation of the
3 globular head that
interacts with a similar structure on the
subunit to form the
complete ligand-binding region (16, 49). The SmaI
site at codon 488 occurs at the beginning of the second repeat (Fig.
5). Within the cysteine-rich repeat region of all the
subunits, the
positions of the cysteines are highly conserved, with seven residues in the first repeat and eight residues in the second through fourth repeats. Similar cysteine-rich repeat regions are also found in laminin
B chains and epidermal growth factor (10). Examination of
the amino acid sequence comparisons between the bovine and human
subunits within this region reveals that the cysteine found at residue
503 in the human subunit has been changed to an arginine in the bovine
subunit. Thus, the region of the bovine
3 subunit that
confers the higher efficiency of utilization of the subunit as a
receptor for FMDV is missing one cysteine residue.
There are six other amino acid changes within the
3
region that confers increased receptor efficiency (Fig.
5), and we have not yet determined which
of these changes may play a role in receptor efficiency. The loss of
the cysteine at residue 503, however, is an intriguing change. The
overall structure of the
subunits, based on primary sequence, is
conserved among many species, and much of that structure appears to be
dependent on the disulfide bonding between cysteine residues
(30). Therefore, reports that cysteine 503 in the human
3 subunit forms a disulfide bond with cysteine 536 in
the third repeat region (15) makes the absence of a cysteine
at this position particularly interesting. The cysteine-rich repeat
region has been implicated in the modulation of integrin activation and
ligand-binding activity. A naturally occurring mutation within this
region in the human
3 subunit is responsible for the
activation of both
v
3 and
IIb
3 (37), and a MAb which binds to the cysteine-rich repeat region of the
1
subunit increases the affinity of the
5
1
integrin for its natural ligand, fibronectin (21). In
addition, binding of
3 integrins to their ligands induces conformational changes within the subunit, exposing new epitopes, defined by their ability to bind certain MAbs. These new
epitopes are known as ligand-induced binding sites (LIBS). The
conformational changes that expose the LIBS can increase the affinity
of the
3 receptor for its ligand (20).
Mapping of a number of LIBS has shown that some of them reside within
the cysteine-rich repeat region (32).
The experiments reported here are indirect measures of receptor
utilization and have not addressed whether the bovine receptor has a
higher affinity for the virus or whether the C-terminal region of the
ectodomain may be mediating an event subsequent to adsorption, either
penetration or eclipse. However, an examination of virus binding in
relation to the level of viral protein synthesis observed in
transfected-infected cells indicated that cells transfected with bovine
subunit cDNA adsorbed higher levels of type A12 virus than
did cells transfected with human integrin cDNAs (data not shown).
Furthermore, analysis of infected cells by IHC using a virus-specific
MAb showed that increased numbers of infected cells were present in
cultures transfected with the bovine
3 subunit (not shown).
Finally, it is interesting to speculate, from the standpoint of
receptor utilization, why foot-and-mouth disease is limited to
cloven-hoofed animals. Results from this and previous studies have
shown that FMDV can utilize human and simian
v
3 as a receptor in cell culture
(11, 47). However, it is quite clear that the virus
replicates to a greater extent in cells expressing the bovine integrin,
specifically the cysteine-rich repeat region of the
3
subunit of that integrin, which has a high degree of structural
conservation among all
subunits (30). Thus, it is
possible that FMDV evolved into a disease of cloven-hoofed livestock
because the structure of their
v
3
receptors resulted in a more advantageous "fit" with the viral
surface that would, in turn, lead to much greater viral replication and
disease within these species. However, since this integrin
probably performs similar functions in a wide variety of species, the
structural differences cannot be radically different, as evidenced by
the high degree of sequence similarity between the bovine and human integrins. It is also important to note that receptors alone may not
necessarily determine FMDV species tropism. Recent results have shown
that a type O virus, isolated from an outbreak which occurred only in
swine in Taiwan in 1997, contained a deletion in nonstructural protein
3A, which led to restricted growth in bovine cells and attenuation in
cattle (9). In the case of poliovirus, which causes disease
only in primates, a murine homolog of the poliovirus receptor has been
found and is unable to bind the virus (46). This inactivity
of the murine homolog has been mapped to a few amino acid differences
with the human homolog in the first immunoglobulin domain of the
receptor (2, 31). We have transfected COS-1 cells with the
murine
3 subunit (a kind gift from Erich Mackow
and Eric Brown) and have found that viral protein synthesis was
comparable to that seen with the human receptor (data not shown).
We are currently cloning the porcine
v and
3 subunits, and it will be interesting to see whether the changes within the
3 cysteine-rich region are
similar those seen in the bovine integrin.
| |
ACKNOWLEDGMENTS |
|---|
We thank Michael LaRocca for excellent technical assistance and William Golde for performing the FACS analysis.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: USDA ARS, Plum Island Animal Disease Center, P.O. Box 848, Greenport, NY 11944-0848. Phone: (631) 323-3354. Fax: (631) 323-2507. E-mail: bbaxt{at}piadc.ars.usda.gov.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Acharya, R., E. Fry, D. Stuart, G. Fox, D. Rowlands, and F. Brown. 1989. The three-dimensional structure of foot-and-mouth disease virus at 2.9 Å resolution. Nature 337:709-716[CrossRef][Medline]. |
| 2. |
Aoki, J.,
S. Koike,
I. Ise,
Y. Sato-Yoshida, and A. Nomoto.
1994.
Amino acid residues on human poliovirus receptor involved in interaction with poliovirus.
J. Biol. Chem.
269:8431-8438 |
| 3. |
Baranowski, E.,
C. M. Ruiz-Jarabo,
N. Sevilla,
D. Andreu,
E. Beck, and E. Domingo.
2000.
Cell recognition by foot-and-mouth disease virus that lacks the RGD integrin-binding motif: flexibility in aphthovirus receptor usage.
J. Virol.
74:1641-1647 |
| 4. | Barteling, S. J., and J. Vreeswijk. 1991. Development in foot-and-mouth disease vaccines. Vaccine 9:75-88[CrossRef][Medline]. |
| 5. | Baxt, B. 1987. Effect of lysosomotropic compounds on early events in foot-and-mouth disease virus replication. Virus Res. 7:257-271[CrossRef][Medline]. |
| 6. | Baxt, B., and Y. Becker. 1990. The effect of peptides containing the arginine-glycine-aspartic acid sequence on the adsorption of foot-and-mouth disease virus to tissue culture cells. Virus Genes 4:73-83[CrossRef][Medline]. |
| 7. | Baxt, B., and P. W. Mason. 1995. Foot-and-mouth disease virus undergoes restricted replication in macrophage cell cultures following Fc receptor-mediated adsorption. Virology 207:503-509[CrossRef][Medline]. |
| 8. |
Baxt, B.,
D. O. Morgan,
B. H. Robertson, and C. H. Timpone.
1984.
Epitopes on foot-and-mouth disease virus outer capsid protein VP1 involved in neutralization and cell attachment.
J. Virol.
51:298-305 |
| 9. |
Beard, C. W., and P. W. Mason.
2000.
Genetic determinants of altered virulence of Taiwanese foot-and-mouth disease virus.
J. Virol.
74:987-991 |
| 10. |
Berg, R. W.,
E. Leung,
S. Gough,
C. Morris,
W.-P. Yao,
S.-X. Wang,
J. Ni, and W. Krissansen.
1999.
Cloning and characterization of a novel integrin-related cDNA coding for the protein TIED ("ten integrin EGF-like repeat domains") that maps to chromosome band 13q33: a divergent stand-alone integrin stalk structure.
Genomics
56:169-178[CrossRef][Medline].
|
| 11. |
Berinstein, A.,
M. Roivainen,
T. Hovi,
P. W. Mason, and B. Baxt.
1995.
Antibodies to the vitronectin receptor (integrin v 3) inhibit binding and infection of foot-and-mouth disease virus to cultured cells.
J. Virol.
69:2664-2666[Abstract].
|
| 12. |
Bhattacharya, S.,
F. Chenzhong,
J. Bhattacharya, and S. Greenberg.
1995.
Soluble ligands of the v 3 integrin mediate enhanced tyrosine phosphorylation of multiple proteins in adherent bovine pulmonary artery endothelial cells.
J. Biol. Chem.
270:16781-16787 |
| 13. |
Bitan, G.,
L. Scheibler,
Z. Greenberg,
M. Rosenblatt, and M. Chorev.
1999.
Mapping the integrin v 3-ligand interface by photoaffinity cross-linking.
Biochemistry
38:3414-3420[CrossRef][Medline].
|
| 14. |
Blystone, S. D.,
F. P. Lindberg,
S. E. LaFlamme, and E. J. Brown.
1995.
Integrin 3 cytoplasmic tail is necessary and sufficient for regulation of 5 1 phagocytosis by v 3 and integrin-associated protein.
J. Cell Biol.
130:745-754 |
| 15. |
Calvete, J. J.,
A. Henschen, and J. González-Rodríguez.
1991.
Assignment of disulphide bonds in human platelet GPIIIa. A disulphide pattern for the -subunits of the integrin family.
Biochem. J.
274:63-71.
|
| 16. |
Carrell, N. A.,
L. A. Fitzgerald,
B. Steiner,
H. P. Erickson, and D. R. Phillips.
1985.
Structure of human platelet membrane glycoproteins IIb and IIIa as determined by electron microscopy.
J. Biol. Chem.
260:1743-1749 |
| 17. |
Cheresh, D.
1987.
Human endothelial cells synthesize and express an arg-gly-asp-directed adhesion receptor involved in attachment to fibrinogen and von Willebrand factor.
Proc. Natl. Acad. Sci. USA
84:6471-6475 |
| 18. |
Cieutat, A. M.,
J. P. Ross,
F. Letourneur,
M. Poncz, and S. Rifat.
1993.
A comparative analysis of cDNA-derived sequences for rat and mouse 3 integrins (GPIIIa) with their human counterpart.
Biochem. Biophys. Res. Commun.
193:771-778[CrossRef][Medline].
|
| 19. |
D'Souza, S. E.,
T. A. Haas,
R. S. Piotrowicz,
V. Byers-Ward,
D. E. McGrath,
H. R. Soule,
C. Cierniewski,
E. F. Plow, and J. W. Smith.
1994.
Ligand and cation binding are dual functions of a discrete segment of the integrin 3 subunit: cation displacement is involved in ligand binding.
Cell
79:659-667[CrossRef][Medline].
|
| 20. |
Du, X.,
M. Gu,
J. W. Weise,
C. Nagaswami,
J. S. Bennett,
R. Bowditch, and M. H. Ginsberg.
1993.
Long range propagation of conformational changes in integrin IIb 3.
J. Biol. Chem.
268:23087-23092 |
| 21. |
Faull, R. J.,
J. Wang,
D. I. Leavesley,
W. Puzon,
G. R. Russ,
D. Vestweber, and Y. Takada.
1996.
A novel activating anti- 1 integrin monoclonal antibody binds to the cysteine-rich repeats in the 1 chain.
J. Biol. Chem.
271:25099-25106 |
| 22. | Fernández, C., K. Clark, L. Burrows, N. R. Schofield, and M. J. Humphries. 1998. Regulation of the extracellular ligand binding activity of integrins. Front. Biosci. 3:684-700. |
| 23. |
Fox, G.,
N. R. Parry,
P. V. Barnett,
B. McGinn,
D. Rowlands, and F. Brown.
1989.
The cell attachment site on foot-and-mouth disease virus includes the amino acid sequence RGD (arginine-glycine-aspartic acid).
J. Gen. Virol.
70:625-637 |
| 24. | Frachet, P., G. Uzan, D. Thevenon, E. Denarier, M. H. Prandini, and G. Marguerie. 1990. GPIIb and GPIIIa amino acid sequences deduced from human megakaryocyte cDNAs. Mol. Biol. Rep. 14:27-33[CrossRef][Medline]. |
| 25. | Fry, E. E., S. M. Lea, T. Jackson, J. W. I. Newman, F. M. Ellard, W. E. Blakemore, R. Abu-Ghazaleh, A. Samuel, A. M. Q. King, and D. I. Stuart. 1999. The structure and function of a foot-and-mouth disease virus-oligosaccharide receptor complex. EMBO J. 18:543-554[CrossRef][Medline]. |
| 26. |
Gavrilovskaya, I. N.,
E. J. Brown,
M. H. Ginsberg, and E. R. Mackow.
1999.
Cellular entry of hantaviruses which cause hemorrhagic fever with renal syndrome is mediated by 3 integrins.
J. Virol.
73:3951-3959 |
| 27. |
Gavrilovskaya, I. N.,
M. Shepley,
R. Shaw,
M. H. Ginsberg, and E. R. Mackow.
1998.
3 integrins mediate the cellular entry of hantaviruses that cause respiratory failure.
Proc. Natl. Acad. Sci. USA
95:7074-7079 |
| 28. |
Gibson, M. A.,
D. I. Leavesley, and L. K. Ashman.
1999.
Microfibril-associated glycoprotein-2 specifically interacts with a range of bovine and human cell types via the v 3 integrin.
J. Biol. Chem.
274:13060-13065 |
| 29. | González-Amaro, R., and F. Sánchez-Madrid. 1999. Cell adhesion molecules: selectins and integrins. Crit. Rev. Immunol. 19:389-429[Medline]. |
| 30. | Green, L., A. P. Mould, and M. J. Humphries. 1998. The integrin beta subunit. Int. J. Biochem. Cell Biol. 30:179-184[CrossRef][Medline]. |
| 31. |
He, Y.,
V. D. Bowman,
S. Mueller,
C. M. Bator,
J. Bella,
X. Peng,
T. S. Baker,
E. Wimmer,
R. J. Kuhn, and M. G. Rossmann.
2000.
Interaction of the poliovirus receptor with poliovirus.
Proc. Natl. Acad. Sci. USA
97:79-84 |
| 32. |
Honda, S.,
Y. Tomiyama,
A. J. Pelletier,
D. Annis,
Y. Honda,
R. Orcheskowski,
Z. Ruggeri, and T. J. Kunicki.
1995.
Topography of ligand-induced binding sites, including a novel cation-sensitive epitope (AP5) at the amino terminus, of the human integrin 3 subunit.
J. Biol. Chem.
270:11947-11954 |
| 33. |
Horton, M. A.
1997.
The v 3 integrin "vitronectin receptor."
Int. J. Biochem. Cell Biol.
29:721-725[CrossRef][Medline].
|
| 34. | Humphries, M. J. 1999. Towards a structural model of an integrin. Biochem. Soc. Symp. 65:63-78[Medline]. |
| 35. | Hynes, R. O. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69:11-25[CrossRef][Medline]. |
| 36. |
Jackson, T.,
F. M. Ellard,
R. Abu-Ghazaleh,
S. M. Brooks,
W. E. Blakemore,
A. H. Corteyn,
D. I. Stuart,
J. W. I. Newman, and A. M. Q. King.
1996.
Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulfate.
J. Virol.
70:5282-5287 |
| 37. |
Kashiwagi, H.,
Y. Tomiyama,
S. Tadokoro,
S. Honda,
M. Shiraga,
H. Mizutani,
M. Handa,
Y. Kurata,
Y. Matsuzawa, and S. J. Shattil.
1999.
A mutation in the extracellular cysteine-rich repeat region of the 3 subunit activates integrins IIb 3 and v 3.
Blood
93:2559-2568 |
| 38. | Kottler, M. L., R. Counis, and H. Degrelle. 1989. Sex steroid-binding protein: identification and comparison of the primary product following cell-free translation of human monkey (Macaca fascicularis) liver RNA. J. Steroid Biochem. 33:201-207[CrossRef][Medline]. |
| 39. |
Lin, E. C. K.,
B. I. Ratnikov,
P. M. Tsai,
C. P. Carron,
D. M. Meyers,
C. F. Barbas III, and J. W. Smith.
1997.
Identification of a region in the integrin 3 subunit that confers ligand binding specificity.
J. Biol. Chem.
272:23912-23920 |
| 40. |
Lindberg, F. P.,
H. D. Gresham,
E. Schwarz, and E. J. Brown.
1993.
Molecular cloning of integrin-associated protein: an immunoglobulin family member with multiple membrane-spanning domains implicated in v 3-dependent ligand binding.
J. Cell Biol.
123:485-496 |
| 41. |
Loftus, J. C.,
C. E. Halloran,
M. H. Ginsberg,
L. P. Feigen,
J. A. Zablock, and J. W. Smith.
1996.
The amino-terminal one-third of IIb defines the ligand recognition specificity of integrin IIb 3.
J. Biol. Chem.
271:2033-2039 |
| 42. | Logan, D., R. Abu-Ghazaleh, W. Blakemore, S. Curry, T. Jackson, A. King, S. Lea, R. Lewis, J. Newman, N. Parry, D. Rowlands, D. Stuart, and E. Fry. 1993. Structure of a major immunogenic site on foot-and-mouth disease virus. Nature 362:566-568[CrossRef][Medline]. |
| 43. |
Martínez, M.,
N. Verdaguer,
M. G. Mateu, and E. Domingo.
1997.
Evolution subverting essentiality: dispensability of the cell attachment arg-gly-asp motif in multiply passaged foot-and-mouth disease virus.
Proc. Natl. Acad. Sci. USA
94:6798-6802 |
| 44. | Mason, P. W., B. Baxt, F. Brown, J. Harber, A. Murdin, and E. Wimmer. 1993. Antibody-complexed foot-and-mouth disease, but not poliovirus, can infect normally insusceptible cells via the Fc receptor. Virology 192:568-577[CrossRef][Medline]. |
| 45. |
Mason, P. W.,
E. Rieder, and B. Baxt.
1994.
RGD sequence of foot-and-mouth disease virus is essential for infecting cells via the natural receptor but can be bypassed by an antibody-dependent enhancement mechanism.
Proc. Natl. Acad. Sci. USA
91:1932-1936 |
| 46. |
Morrison, M. E., and V. R. Racaniello.
1992.
Molecular cloning and expression of a murine homolog of the human poliovirus receptor gene.
J. Virol.
66:2807-2813 |
| 47. |
Neff, S.,
Sá- Carvalho,
E. Rieder,
P. W. Mason,
S. D. Blystone,
E. J. Brown, and B. Baxt.
1998.
Foot-and-mouth disease virus virulent for cattle utilizes the integrin v 3 as its receptor.
J. Virol.
72:3587-3594 |
| 48. |
Nelsen-Salz, B.,
H. J. Eggers, and H. Zimmermann.
1999.
Integrin v 3 (vitronectin receptor) is a candidate receptor for the virulent echovirus 9 strain Barty.
J. Gen. Virol.
80:2311-2313 |
| 49. | Nermut, M. V., N. M. Green, P. Eason, S. S. Yamada, and K. M. Yamada. 1988. Electron microscopy and structural model of human fibronectin receptor. EMBO J. 7:4093-4099[Medline]. |
| 50. |
Pulli, T.,
E. Koivunen, and T. Hyypiä.
1997.
Cell-surface interactions of echovirus 22.
J. Biol. Chem.
272:21176-21180 |
| 51. |
Rieder, E.,
B. Baxt, and P. W. Mason.
1994.
Animal-derived antigenic variants of foot-and-mouth disease virus type A12 have low affinity for cells in culture.
J. Virol.
68:5296-5299 |
| 52. |
Rieder, E.,
T. Bunch,
F. Brown, and P. W. Mason.
1993.
Genetically engineered foot-and-mouth disease viruses with poly(C) tracts of two nucleotides are virulent in mice.
J. Virol.
67:5139-5145 |
| 53. |
Roivainen, M.,
L. Piiraninen,
T. Hovi,
I. Virtanen,
T. Rikonen,
J. Heino, and T. Hyypiä.
1994.
Entry of coxsackievirus A9 into host cells: specific interaction with v 3 integrin, the vitronectin receptor.
Virology
203:357-365[CrossRef][Medline].
|
| 54. | Sá-Carvalho, D., E. Rieder, B. Baxt, R. Rodarte, A. Tanuri, and P. W. Mason. 1997. Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. J. Virol. 71:5115-5123[Abstract]. |
| 55. |
Schneider, G. B.,
S. W. Whitson, and L. F. Cooper.
1999.
Restricted and coordinated expression of 3-integrin and bone sialoprotein during cultured osteoblast differentiation.
Bone
24:321-327[Medline].
|
| 56. |
Smith, J. W., and D. A. Cherish.
1988.
The arg-gly-asp binding domain of the vitronectin receptor. Photoaffinity cross-linking implicates amino acid residues 61-203 of the subunit.
J. Biol. Chem.
263:18726-18731 |
| 57. |
Smith, J. W., and D. A. Cheresh.
1990.
Integrin ( v 3)-ligand interaction. Identification of a heterodimeric RGD binding site on the vitronectin receptor.
J. Biol. Chem.
265:2168-2172 |
| 58. |
Starr, C. M., and J. A. Hanover.
1990.
Glycosylation of nuclear pore protein p62. Reticulocyte lysate catalyzes O-linked N-acetylglucosamine addition in vitro.
J. Biol. Chem.
265:6868-6873 |
| 59. | Stave, J. W., J. L. Card, D. O. Morgan, and V. N. Vakharia. 1988. Neutralization sites of type O1 foot-and-mouth disease virus defined by monoclonal antibodies and neutralization-escape virus variants. Virology 161:21-29. |
| 60. |
Suzuki, S.,
W. S. Argraves,
H. Arai,
L. R. Languino,
M. D. Pierschbacher, and E. Ruoslahti.
1987.
Amino acid sequence of the vitronectin receptor subunit and comparative expression of the adhesion receptor mRNAs.
J. Biol. Chem.
262:14080-14085 |
| 61. |
Takagi, J.,
T. Kamata,
J. Meredith,
W. Puzon-McLaughlin, and Y. Takada.
1997.
Changing ligand specificities of v 1 and v 3 integrins by swapping a short diverse sequence of the subunit.
J. Biol. Chem.
272:19794-19800 |
| 62. |
Tozer, E. C.,
R. C. Liddington,
M. J. Sutcliffe,
A. H. Smeeton, and J. C. Loftus.
1996.
Ligand binding to integrin IIb 3 is dependent on a MIDAS-like domain in the 3 subunit.
J. Biol. Chem.
271:21978-21984 |
| 63. |
Wada, J.,
A. Kumar,
Z. Liu,
E. Ruoslahti,
L. Reichardt,
J. Marvaldi, and Y. S. Kanwar.
1996.
Cloning of mouse integrin v cDNA and role of the v related matrix receptors in metanephric development.
J. Cell Biol.
132:1161-1176 |
| 64. |
Wickham, T. J.,
P. Mathias,
D. A. Cheresh, and G. R. Nemerow.
1993.
Integrins v 3 and v 5 promote adenovirus internalization but not virus attachment.
Cell
73:309-319[CrossRef][Medline].
|
| 65. | Zimrin, A. B., R. Eisman, G. Vilaire, E. Schwartz, J. S. Bennett, and M. Poncz. 1988. Structure of platelet glycoprotein IIIa. A common subunit for two different membrane receptors. J. Clin. Investig. 81:470-475. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»