Previous Article | Next Article 
Journal of Virology, July 2000, p. 6162-6167, Vol. 74, No. 13
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The C-Terminal Proline-Rich Tail of Human Immunodeficiency Virus
Type 2 Vpx Is Necessary for Nuclear Localization of the Viral
Preintegration Complex in Nondividing Cells
Heather A.
Pancio,
Nancy
Vander Heyden, and
Lee
Ratner*
Departments of Medicine, Pathology, and
Molecular Microbiology, Washington University School of Medicine,
St. Louis, Missouri 63110
Received 14 January 2000/Accepted 17 March 2000
 |
ABSTRACT |
Human immunodeficiency virus type 2 (HIV-2), like other
lentiviruses, is capable of infecting nondividing T cells and
macrophages. The present work shows that in HIV-2-infected cells, Vpx
is necessary for efficient nuclear import of the preintegration
complex. In agreement with this finding, the subcellular localization
of a GFP-Vpx fusion protein was found to be predominantly nuclear. However, deletion of the proline-rich C-terminal 11 residues of Vpx
resulted in a shift of the fusion protein to the cytoplasm. Furthermore, the same deletion in the context of the provirus resulted
in a decrease in nuclear import of the preintegration complex and
attenuated replication in macrophages.
| |
TEXT |
A critical step in the process of
retrovirus infection is the transfer of viral DNA into the nucleus of
the infected cell (7). Once inside the nucleus, the linear
proviral DNA integrates into the host genome, where it can be
transcribed to form a full-length progeny RNA genome and mRNAs encoding
viral proteins. Nuclear import of oncoretroviral DNA requires
dissolution of the nuclear envelope with mitosis. In contrast,
lentiviruses are also able to perform this task by exploiting cellular
pathways for active nuclear import (23). Thus, lentiviruses
are capable of infecting nondividing cells, such as terminally
differentiated macrophages and memory T cells, which are important for
viral dissemination and persistence (17).
The main cellular pathway for nuclear import is the importin pathway,
wherein the import substrate binds via its nuclear localization signal
(NLS) to the importin 
/
heterodimer in the cytoplasm (14,
33). Importin is responsible for binding to the NLS (14,
22, 46). The simplest NLS consists of a short stretch of 5 to 7 basic residues, whereas a bipartite NLS includes two basic domains
separated by 10 to 11 residues. After importin binds the NLS,
importin mediates the docking of the import substrate to the
nuclear pore (15). Nuclear pore proteins, which often contain FXFG repeats, function as docking sites at the nuclear envelope
(40, 41). Two other proteins, Ran and p10, mediate the
translocation of the import complex across the nuclear pore (29,
30).
Upon entry of the human immunodeficiency virus (HIV) virion core into
the newly infected cell, viral proteins required for nuclear import and
integration remain associated with the viral nucleic acids
(8). After reverse transcription, this high-molecular-weight nucleoprotein complex is referred to as the viral preintegration complex. Three proteins in HIV-1 have been implicated in the nuclear localization of this complex: matrix (MA), integrase (IN), and viral
protein R (Vpr), although there is controversy about the role of MA in
this process (10). Each of these proteins has been shown to
bind importin (12, 13, 38, 45). MA and IN bind in an
NLS-dependent manner, and their binding is inhibited by a peptide
including the simian virus 40 large T antigen NLS sequence. In
contrast, Vpr binds importin in an NLS-independent manner (12,
13). MA contains a putative basic-type NLS spanning residues 25 to 33. HIV-1 strains with mutations in this region of lysines to
threonines (26KK
TT or 27KT) are
attenuated in their ability to replicate in nondividing cells when Vpr
is also absent (MA
NLSVPR) (3). The same
mutation abrogates binding of MA to importin (13). IN binds to importin through an atypical bipartite NLS located within
its C terminus. Mutation of this sequence in an
MANLSVPR virus results in a more complete block in
nuclear import of the preintegration complex (12).
Vpr does not bind importin at its NLS binding site (12,
13). This was demonstrated in experiments that showed that Vpr does not compete with MA for importin binding. Instead, Vpr increases the affinity of importin for the NLS of MA
(38). In addition to binding importin , Vpr also binds to
FXFG repeat-containing nucleoporins (45) and has been
postulated to stabilize docking of viral preintegration complexes to
the nuclear pore (39).
When expressed in the absence of other viral proteins, Vpr localizes to
the nucleus (5, 25, 27) and the nuclear envelope (45). Vpr does not contain a region which resembles an NLS. Mutations within an N-terminal -helical region block nuclear localization (5, 26, 47). In addition, mutations in the leucine-isoleucine-rich domain and the arginine-rich C terminus of Vpr
impair its nuclear targeting function (26, 49). Some of
these mutations may alter subcellular localization due to global effects on Vpr conformation and/or stability, while others may specifically disrupt a domain critical for nuclear localization. Vpr
may contain a novel nuclear targeting signal or perhaps a region
important for protein-protein interactions with an NLS-containing protein (piggyback binding). Alternatively, the domain could be important for nuclear retention after passive diffusion of Vpr into the nucleus.
In addition to Vpr, HIV-2 and members of the simian immunodeficiency
virus SIVsm/SIVmac lineage encode Vpx. Vpx and Vpr share considerable
homology (42, 44). Like Vpr, Vpx is virion associated and
recruited into virions through its interaction with the p6 portion of
the Gag polyprotein (1, 34, 47). Also similar to Vpr, one
study demonstrated that Vpx, when expressed in the absence of other
viral components, is a nuclear protein (5). However, another
group has described a perinuclear distribution for this accessory
protein (47). Both Vpr and Vpx are found at high
concentrations within the virion, in amounts comparable to that of Gag
proteins. This suggests an important function early in infection.
Despite the similarities of Vpr and Vpx, Fletcher and colleagues
demonstrated that the two accessory proteins mediate distinct functions
during SIV infection (9). In a highly pathogenic variant of
SIV, SIVSM PBj1.9, the primary function of Vpr is induction of cell cycle arrest in G2, whereas SIVSM Vpx
functions in the nuclear import of the preintegration complex. Cells
expressing SIVSM Vpx, but not Vpr, were not arrested in
G2, and viruses which retained Vpr but lacked Vpx were
unable to efficiently infect nondividing cells. In contrast to the
finding of redundant nuclear import signals present in the HIV-1
preintegration complex, this study showed that SIVSM PBj1.9
Vpx is both necessary and sufficient for the nuclear import of the
preintegration complex.
The present study was designed to assess the role of HIV-2 Vpx in
nuclear import processes. Similar to the observations with SIVSM PBj1.9 Vpx, HIV-2 Vpx is necessary for nuclear import
of the viral preintegration complex. In addition, we have addressed the
controversy concerning the cellular localization of Vpx. Finally, we
sought to identify regions of the protein important for its subcellular
localization. To accomplish this, we created green fluorescent protein
(GFP) fusion proteins with wild-type HIV-2 Vpx and several mutant forms
of the protein and assessed their distribution in transfected cells.
Interestingly, the C-terminal proline-rich tail of Vpx appears to be
important both for Vpx nuclear localization and nuclear import of the
preintegration complex.
HIV-2 Vpx is necessary for nuclear import of viral cDNA.
In
order to determine whether HIV-2 Vpx is sufficient for nuclear import
in nondividing cells, we generated HIV-2ROD proviral clones with mutations in vpx, vpr, and the
coding sequence for the NLS of MA. The functional HIV-2ROD
proviral clone, pSE (20), was digested with SalI
to remove flanking cellular sequences, which generated pES. Mutant
pMX1+62, designated MX here, has been described previously
(20) and includes mutations of both methionine codons of
vpx. The pMANLSMRMX clone has the
MX1+62 vpx mutation, along with a G4700T change within
vpr, which converts the seventh codon to a termination
codon, and a 26KT mutation in the NLS of MA. Mutagenesis
of the MA NLS was carried out by a PCR-based overlap extension method,
described previously (18). This MA mutation in HIV-1 blocks
the ability of the virus to infect nondividing cells in the absence of
functional Vpr (3). All mutations were confirmed by sequence analysis.
293T cells were transfected with 5 µg of the proviral DNAs by using
Lipofectamine (Gibco). The supernatants of transfected cells were
filtered 48 h posttransfection, and viral stocks were treated with
2 µg of DNase per ml in 10 mM MgCl2 for 30 min at 37°C.
Viral stock concentrations were determined by p27 antigen-capture enzyme-linked immunosorbent assay (Coulter), and infectious titers were normalized by using CCR5-transfected Magi cells (21,
36).
U937 cells were maintained in RPMI1640 supplemented with 10% fetal
bovine serum. To induce G
1/S arrest, cells were
synchronized
by serum starvation for 48 h followed by release into
complete
medium containing 400 µM mimosine (
31). Cells
were infected
with 50 ng of p27 of wild-type (ES) or mutant (MX,
MA
NLSMRMX,
or ES-X101) DNase-treated HIV-2. Cells were
collected at 6, 12,
24, and 48 h postinfection, and total DNA was
isolated with the
DNAzol reagent according to the manufacturer's
protocol
(Gibco).
Two-long terminal repeat (LTR) circle forms of HIV-2 DNA were amplified
with
32P-end-labeled primers to the HIV-2 LTR U5
nucleotides 238 to 217
(5'-TTACTCAGGTGAACACCGAAT) and 278 to
299 (5'ACCGAGGCAGGAAAATCCCTA).
Late reverse transcription
products were amplified with end-labeled
primers to LTR U5 nucleotides
278 to 299 and nucleotides 625 to
594 of
gag
(5'-GTCTTTCCCCCGGGCCGTAACCTCATTCTTTC). Standards were
generated by conducting PCRs with serial dilutions of chronically
infected CEM cells with the primers
indicated.
PCR analysis of cellular DNA obtained immediately after infection gave
no visible product (data not shown). Linear reverse
transcription
products, which were synthesized in the cytoplasm
of infected cells,
were amplified with U5/
gag primers and were
detectable at
equivalent levels in cells infected by all three
viruses and within
6 h after infection (Fig.
1).
Therefore, none
of the mutations that we have introduced into the virus
affect
fusion, early postentry events, or reverse transcription. The
two-LTR circular form of viral DNA, which is only found in the
nuclei
of infected cells and serves as a surrogate marker of nuclear
import,
was selectively amplified by using U5 primers. Markedly
reduced levels
of two-LTR circular DNA were found in both the
MA
NLSMRMX- and MX-infected cells, compared to
ES-infected
cells. Moreover, neither Vpr nor MA compensated for the
loss of
Vpx function in promoting nuclear import. Thus, HIV-2 Vpx is
the
predominant nuclear import factor of the viral preintegration
complex, similar to what has been reported for SIV
SM PBj1.9
Vpx
(
9).
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Vpx is required for nuclear localization of viral
reverse-transcribed DNA products. At the indicated times
postinfection with ES, MX, or MANLSMRMX, total cellular
DNA was isolated from arrested U937 cells. PCR was performed with
U5/gag primers and U5/U5 primers to detect viral DNA
synthesis and nuclear localization, respectively. Standards were
derived from reactions with the identical primers on serial dilutions
of chronically infected cells. Representative results are shown from
three different experiments which all yielded similar results.
|
|
Localization of GFP-Vpx fusion proteins.
In order to assess
the subcellular localization of Vpx, wild-type and mutant forms of
vpx were cloned into a plasmid which generates a fusion
protein with GFP at the N terminus. The Vpx mutations that we studied
included a deletion of residues 20 to 40 (AH), a region predicted to
form an amphipathic helix, a truncation at residue 89 (X89), and a
truncation at residue 101 (X101) (34). The last two
mutations remove a highly conserved stretch of prolines found in
C-terminal residues 102 to 112 of Vpx (11). Wild-type and
mutant vpx constructs described previously (34)
were amplified by PCR with primers which introduced a 5'
BspE1 site and a 3' XhoI site. PCR products were
then cloned into the pEGFP-C1 vector (Clontech), which had been
digested with BspE1-XhoI. All constructs were
confirmed by sequence analysis.
The DNAs were transfected into 293T or HeLa cells, and 48 h later,
the distribution of GFP fusion proteins was determined
by confocal
microscopy. These cells were maintained in Dulbecco's
modified
Eagle's medium with 10% fetal bovine serum, plated onto
chamber
tissue culture slides (Falcon), grown to 50 to 70% confluency,
and
transfected with the GFP DNAs and, in the indicated cases,
with the
HIV-2
gag-pol expression plasmid, pTM-GP2, described
previously (
19). After 19 h, cells transfected with
pTM-GP2
were infected at a multiplicity of infection (MOI) of 10 with
vaccinia virus vTF7-3, expressing T7 polymerase. After 24 h, the
cells were fixed in 2% paraformaldehyde for 20 min and examined
on a
Zeiss axiovert microscope equipped with a Bio-Rad confocal
scanning
imaging
system.
GFP alone is distributed diffusely throughout the cells (Fig.
2A). GFP-Vpx had a predominantly nuclear
localization (Fig.
2D to F), although it was occasionally observed in a
perinuclear
distribution (data not shown). All of the fusion proteins
showed
a shift in localization to the plasma membrane when coexpressed
with HIV-2 Gag (Fig.
2H and I, and data not shown), indicating
that the
GFP moiety did not interfere with the ability of Vpx
to interact with
Gag. GFP-AH had a distribution similar to that
of GFP-Vpx (Fig.
2G). In
contrast, both GFP-X89 and GFP-X101 had
a diffuse cellular
distribution, with both nuclear and cytoplasmic
localization (Fig.
2B
and C).
View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
The C-terminal proline-rich tail of Vpx is important for
nuclear localization. 293T cells were transfected with GFP constructs
with or without HIV-2 Gag (pTM-GP2). The GFP fusion proteins included
wild-type Vpx, X101, X89, and XAH. Cells transfected with pTM-GP2 were
infected with vaccinia virus 19 h posttransfection and fixed in
2% paraformaldehyde 24 h posttransfection.
|
|
The size of the fusion proteins is relatively small (<47 kDa),
allowing for their passive diffusion in and out of the nucleus.
In the
absence of an organelle targeting or retention signal,
we would expect
a diffuse cellular distribution. The distribution
of GFP-X89 and
GFP-X101 looks remarkably like that of GFP
alone.
293T cells were transfected with GFP constructs and metabolically
labeled overnight by using methionine- and cysteine-free
medium
supplemented with 50 µCi of Tran[
35S]label (ICN) per
ml. Cells were solubilized in radioimmunoprecipitation
assay (RIPA)
buffer (1% Triton X-100, 0.5% deoxycholate, 0.1%
sodium dodecyl
sulfate [SDS], 0.2 mM phenylmethylsulfonyl fluoride),
clarified, and
incubated with 5 µl of polyclonal anti-Vpx antiserum.
Twenty
microliters of protein A-Sepharose beads was added, and
the incubations
were continued for an additional hour. Precipitates
were washed three
times with RIPA buffer, boiled for 2 min in
Laemmli sample buffer, and
analyzed on an SDS-12% polyacrylamide
gel. Labeled proteins were
detected by
autoradiography.
One potential explanation for these results is that GFP-X89 and
GFP-X101 could be less stable than GFP-Vpx or GFP-XAH. However,
the
truncation of HIV-2 Vpx at either residue 89 or 101 did not
affect
protein stability (
34). The GFP-X101 fusion protein was
expressed in transfected 293T cells at levels comparable to those
of
GFP-Vpx (Fig.
3). Therefore, it appears
that the C-terminal
11 residues of Vpx are important either for nuclear
targeting
or for nuclear retention of the protein.
View larger version (90K):
[in this window]
[in a new window]
|
FIG. 3.
GFP-Vpx101 and GFP-Vpx fusion proteins are expressed at
equivalent levels. 293T cells transfected with GFP, GFP-Vpx, and
GFP-Vpx101 were metabolically labeled overnight with
Tran[35S] label. Protein expression was assessed by
immunoprecipitation with anti-Vpx antiserum followed by
SDS-polyacrylamide gel electrophoresis. M.W., molecular mass markers.
|
|
The C-terminal tail of Vpx is required for efficient nuclear
targeting of viral cDNA.
In order to assess the functional
importance of the C-terminal 11 residues of Vpx, we generated a
provirus which contained Vpx 101 in place of the wild-type protein. The
vpx mutant pES-X101 was generated by performing PCR-based
overlap mutagenesis on pES to remove a SacI site at the 5'
end of vpr. Two flanking SacI sites were used for
digestion and subcloning into pUC19 to generate pUC19-VpxMS. A
StuI-XhoI fragment from vpx deletion
mutant pTM-X101, described previously (34), was ligated into
pUC19-VpxMS digested with StuI-XhoI. The entire
SacI fragment was then religated back into pES.
We used this virus in the PCR assay described above in order to
determine its effects on nuclear import. A block in nuclear
import is
evident in cells infected with the ES-X101 virus, compared
to cells
infected with ES, as indicated by the decrease in accumulation
of
two-LTR circles (Fig.
4). Equivalent
levels of cytoplasmic
reverse transcription products were observed for
ES and ES-X101,
demonstrating that this mutation has not altered early
infection
events.
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4.
Deletion of the C-terminal tail of Vpx leads to a block
in nuclear localization of viral DNA. Nondividing U937 cells were
infected with ES or ES-X101, and total cellular DNA was isolated at the
indicated times. Viral DNA was detected by using the same PCR primers
as in Fig. 1, which differentiate between DNA synthesis and nuclear
import events. Results from one of two experiments giving similar
results are shown.
|
|
HIV-2 Vpx promotes productive infection of macrophages.
To
ensure that the results obtained in the PCR assay are representative of
events occurring during natural infection of nondividing cells, we
examined the ability of viruses lacking Vpx or containing the truncated
form of Vpx to elicit a spreading infection of monocyte-derived macrophages (MDMs). For infection of MDMs, blood monocytes were isolated from the peripheral blood of healthy blood donors by elutriation to >99% purity and allowed to differentiate in Iscove's medium containing 10% human serum and 500 U of macrophage
colony-stimulating factor/ml. Infections were carried out by using 50 ng of p27 1 week after differentiation. Supernatants were collected
every 3 to 4 days for 21 to 27 days and analyzed for exogenous reverse transcriptase (RT) activity (37).
Equivalent amounts of ES, MX, and ES-X101, based on titers in
CCR5-expressing Magi cells, were used to infect macrophages
(Fig.
5). In three independent experiments with
macrophages from
different donors, significantly higher levels of RT
activity were
generated from ES-infected macrophages, than from MX- or
ES-X101-infected
macrophages.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
The C-terminal tail of Vpx is required for efficient
HIV-2 replication in primary human macrophages. MDMs from three
different donors were infected with equivalent amounts of infectious
ES, MX, or ES-X101, as determined by assay on Magi-CCR5 cells. Virus
expression was measured by RT activity measurements every 3 to 4 days.
|
|
Conclusions.
In this study, we demonstrated that HIV-2 Vpx is
necessary for efficient nuclear import of viral DNA in nondividing
cells. Our results indicate that the presence of intact MA and Vpr does not compensate for the lack of Vpx. This is in contrast to data reported for HIV-1, where MA, Vpr, and IN have redundant functions in
terms of nuclear import of the preintegration complex (3, 12,
16). However, our findings are in agreement with the findings of
Fletcher and colleagues using SIVSM PBj1.9 (9).
One possible explanation for this discrepancy is that HIV-1 Vpr is the
predominant mediator of nuclear import, and MA and IN are very weak
karyophiles. Indeed, Fouchier and colleagues reported that the putative
NLS within MA does not play a role in nuclear localization of the preintegration complex and that the 26KKTT mutations
introduced into this sequence affect posttranslational processing of
Gag by the viral protease, rather than nuclear localization (10). They demonstrated that the replication kinetics of a
26KKTT HIV-1 virus were equivalently decreased in both
dividing and nondividing cells, in support of their hypothesis.
However, these findings do not explain the ability of MA residues 25 to 33, when conjugated to bovine serum albumin (BSA), to direct its nuclear import (3). The 26KKTT mutation
within this sequence blocked nuclear import of BSA, further indicating
that residues 25 to 33 comprise a functional NLS. Nor does it explain
the observed interaction between MA and importin , which is an
NLS-dependent interaction (13). In contrast, Popov and
colleagues suggest that there are multiple weak karyophilic components
within the viral preintegration complex, including those in MA and IN
(39). They suggest that the primary function of Vpr, or
perhaps Vpx, is to stabilize the interaction between importin and
these relatively weak karyophiles. In support of this theory, Vpr binds
to importin at a different binding site than does MA, and the
MA-importin interaction is resistant to competition by the addition
of exogenous NLS peptide in the presence of Vpr (39).
Some of the confusion surrounding the role of these various viral
proteins in nuclear import may be attributable to subtle
differences in
experimental conditions. It has been reported that
the role of
integrase in nuclear import is apparent only when
cells are infected at
a relatively high MOI (
12). At a high
MOI, weaker
karyophilic signals found in the preintegration complex,
such as those
found in MA and IN, could function in nuclear import
to levels
detectable by the PCR assay or macrophage infection
experiments.
HIV-2 Vpx is primarily a nuclear protein, as indicated by GFP-Vpx
fusion protein localization. However, a perinuclear distribution
of the
protein was observed in some cells, as reported by others
(
47). This appears to be in a discrete location outside of
the
nucleus, perhaps the endoplasmic reticulum or Golgi apparatus,
rather than an association with the nuclear envelope as has been
reported for HIV-1 Vpr (
45). This suggests that Vpx may have
another function in HIV-2-infected cells, separable from its role
in
nuclear localization. GFP-Vpx shifts to the plasma membrane
when
coexpressed with HIV-2 Gag, and it is efficiently packaged
into HIV-2
virions when coexpressed with MX virus (data not shown).
These findings
support the notion that GFP-Vpx functions in a
manner similar to that
of Vpx alone. Furthermore, our localization
results using GFP-Vpx are
identical to those obtained by standard
immunofluorescence
techniques with Vpx-expressing cells (data
not
shown).
The current work sought to identify the domain of Vpx important for
nuclear localization. Deletion of residues 20 to 40 within
Vpx results
in a predominantly nucleus-localized protein, similar
to wild-type Vpx.
This result differs from those obtained with
HIV-1 Vpr where
substitutions within the N-terminal amphipathic
helix abrogated nuclear
localization (
5,
26,
48). It should
not be surprising that
the two accessory proteins do not use the
same mechanism for nuclear
import, since they also use distinct
domains within Gag for virion
incorporation (
1,
24,
34,
47). Despite their homology, Vpr
and Vpx have evolved distinct
ways to interact with viral and cellular
components.
Truncation of Vpx, at either residue 89 or 101, leads to a diffuse
subcellular distribution, suggesting that a sequence important
for
nuclear localization has been perturbed. The C-terminal 10
residues of
Vpx consist of a highly conserved motif of seven prolines
followed by
glycine, leucine, and valine (P
7GLV). This motif is
invariant in all of the Vpx proteins identified in HIV-2 and SIV
isolates. Such strong sequence conservation suggests an important
function for this domain, yet none has been identified. The
proline-rich
tail is dispensable for virion incorporation of Vpx, and
it is
dispensable for efficient SIV replication in dividing cells
(
35).
Park and colleagues (
35) suggested that
this domain may be important
for SIV
mac Vpx protein
stability, but we have previously demonstrated
that this is not the
case for HIV-2 Vpx (
34). The data presented
here suggest
that this proline-rich domain may be important for
the targeting of Vpx
to the nucleus. However, it remains to be
determined if residues 102 to
112 are sufficient to target a heterologous
protein to the nucleus. A
similar sequence is not found within
Vpr, suggesting that it mediates
nuclear import by a novel mechanism.
At least two possibilities could
explain how residues 102 to 112
function in nuclear localization. This
portion of Vpx could contain
a previously unidentified class of NLS, or
the proline-rich domain
could be important for protein-protein
interactions with a second
nucleus-targeted
protein.
In terms of the first model, in which the C-terminal residues of Vpx
contain a unique NLS, it is clear that the P
7GLV motif
does
not resemble a canonical NLS. However, Shoya and colleagues
identified
two novel NLSs within the P phosphoprotein of Borna
disease virus which
are rich in prolines and lack basic amino
acids (
43).
Mutational analyses of these sequences demonstrated
that the prolines
were required for nuclear targeting activity.
It will be interesting to
determine if mutation of the prolines
of Vpx affects nuclear
import.
With regard to the possibility that Vpx uses the C-terminal tail to
interact with another protein and thereby piggyback into
the nucleus,
the proline-rich region of Vpx could be important
for protein-protein
interaction. SH3 domains bind proline-rich
ligands through recognition
of a PXXP motif (
32). WW domains
bind proline-rich ligands
in WW-binding proteins by recognizing
an expanding array of motifs. For
example, the Yes-associated
protein, YAP, has a WW domain that binds a
PPXY motif (
4),
and the formin-binding protein, FBP11,
recognizes a PPLP motif
(
2). It is interesting that the
majority of WW-binding proteins
identified to date are nuclear proteins
(
2). Proteins have
been identified in yeast,
Drosophila, mice, and humans, such as
guanylate kinase
MAGI-1, which contains both WW domains and NLSs
(
6,
28). It
is tempting to speculate that proteins lacking
a canonical NLS can use
proline-rich domains for binding to WW
domain proteins that can then
escort them into the
nucleus.
The current work has identified a primary function of HIV-2 Vpx and has
mapped a domain critical for accomplishing this function.
It will be
interesting to determine if HIV-2 Vpx has a role in
docking the viral
preintegration complex to the nuclear pore,
similar to what has been
reported for Vpr in HIV-1. To address
this, binding studies should
determine if Vpx can interact with
nucleoporins. It will also be
interesting to elucidate the cellular
pathway that Vpx exploits for its
nuclear import. Binding studies
between Vpx and importin
have not
been done as of yet. Such
studies may reveal that these two proteins
can interact in an
NLS-independent manner. Alternatively, Vpx may use a
pathway distinct
from the importin pathway, such as one involving the
WW proteins
or other proline-rich binding proteins. Such studies may
prove
useful in identifying alternative cellular pathways for nuclear
import.
| |
ACKNOWLEDGMENTS |
We thank Charles Rice for helpful discussions.
This work was supported by PHS grants AI36071 and AI34736 and training
grant AI07172.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Box 8069, Washington University School of Medicine, 660 S. Euclid Ave., St.
Louis, MO 63110. Phone: (314) 362-8836. Fax: (314)
747-2797. E-mail: LRATNER{at}IMGATE.WUSTL.EDU.
| |
REFERENCES |
| 1.
|
Accola, M. A.,
A. A. Bukovsky,
M. S. Jones, and H. G. Göttlinger.
1999.
A conserved dileucine-containing motif in p6gag governs the particle association of Vpx and Vpr of simian immunodeficiency viruses SIVmac and SIVagm.
J. Virol.
73:9992-9999[Abstract/Free Full Text].
|
| 2.
|
Bedford, M. T.,
D. C. Chan, and P. Leder.
1997.
FBP WW domains and the Abl SH3 domain bind to a specific class of proline-rich ligands.
EMBO J.
16:2376-2383[CrossRef][Medline].
|
| 3.
|
Bukrinsky, M. I.,
S. Haggerty,
M. P. Dempsey,
N. Sharova,
A. Adzhubei,
L. Spitz,
P. Lewis,
D. Goldfarb,
M. Emerman, and M. Stevenson.
1993.
A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells.
Nature
365:666-669[CrossRef][Medline].
|
| 4.
|
Chen, H. I., and M. Sudol.
1995.
The WW domain of Yes-associated protein binds a proline-rich ligand that differs from the consensus established for Src homology 3-binding modules.
Proc. Natl. Acad. Sci. USA
92:7819-7823[Abstract/Free Full Text].
|
| 5.
|
Di Marzio, P.,
S. Choe,
M. Ebright,
R. Knoblauch, and N. R. Landau.
1993.
Mutational analysis of cell cycle arrest, nuclear localization, and virion packaging of human immunodeficiency virus type 1 Vpr.
J. Virol.
69:7909-7916[Abstract].
|
| 6.
|
Dobrosotskaya, I.,
R. K. Guy, and G. L. James.
1997.
MAGI-1, a membrane-associated guanylate kinase with a unique arrangement of protein-protein interaction domains.
J. Biol. Chem.
272:31589-31597[Abstract/Free Full Text].
|
| 7.
|
Emerman, M.
1996.
HIV-1, Vpr and the cell cycle.
Curr. Biol.
6:1096-1103[CrossRef][Medline].
|
| 8.
|
Farnet, C. N., and W. A. Haseltine.
1990.
Integration of human immunodeficiency virus type 1 DNA in vitro.
Proc. Natl. Acad. Sci. USA
87:4164-4168[Abstract/Free Full Text].
|
| 9.
|
Fletcher, T. M.,
B. Brichacek,
N. Sharova,
M. A. Newman,
G. Stivahtis,
P. M. Sharp,
M. Emerman,
B. H. Hahn, and M. Stevenson.
1996.
Nuclear import and cell cycle arrest of the HIV-1 vpr protein are encoded by two separate genes in HIV-2/SIVsm.
EMBO J.
15:6155-6165[Medline].
|
| 10.
|
Fouchier, R. A. M.,
B. E. Meyer,
J. H. M. Simon,
U. Fischer, and M. H. Malim.
1997.
HIV-1 infection of non-dividing cells: evidence that the amino-terminal basic region of the viral matrix protein is important for gag processing but not for post-entry nuclear import.
EMBO J.
16:4531-4539[CrossRef][Medline].
|
| 11.
|
Franchini, G.,
J. R. Rusche,
T. J. O'Keeffe, and F. Wong-Staal.
1988.
The human immunodeficiency virus type 2 (HIV-2) contains a novel gene encoding a 16 kD protein associated with mature virions.
AIDS Res. Hum. Retrovir.
4:243-250[Medline].
|
| 12.
|
Gallay, P.,
T. Hope,
D. Chin, and D. Trono.
1997.
HIV-1 infection of nondividing cells through the recognition of integrase by the importin/karyopherin pathway.
Proc. Natl. Acad. Sci. USA
94:9825-9830[Abstract/Free Full Text].
|
| 13.
|
Gallay, P.,
V. Stitt,
C. Mundy,
M. Oettinger, and D. Trono.
1996.
Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import.
J. Virol.
70:1027-1032[Abstract].
|
| 14.
|
Gorlich, D.,
H. Kostka,
R. Kraft,
C. Dingwall,
R. A. Laskey,
E. Hartmann, and S. Prehn.
1995.
Two different subunits of importin cooperate to recognize nuclear localization signals and bind them to the nuclear envelope.
Curr. Biol.
5:383-392[CrossRef][Medline].
|
| 15.
|
Gorlich, D.,
S. Prehn,
R. A. Laskey, and E. Hartmann.
1994.
Isolation of a protein that is essential for the first step of nuclear protein import.
Cell
79:767-778[CrossRef][Medline].
|
| 16.
|
Heinzinger, N. K.,
M. I. Bukrinsky,
S. A. Haggerty,
A. M. Ragland,
V. Kewalramani,
M.-A. Lee,
H. E. Gendelman,
L. Ratner,
M. Stevenson, and M. Emerman.
1994.
The vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells.
Proc. Natl. Acad. Sci. USA
91:7311-7315[Abstract/Free Full Text].
|
| 17.
|
Hirsch, V. M.,
M. E. Sharkey,
C. R. Brown,
B. Brichacek,
S. Goldstein,
J. Wakefield,
R. Byrum,
W. R. Elkins,
B. H. Hahn,
J. D. Lifson, and M. Stevenson.
1998.
Vpx is required for dissemination and pathogenesis of SIVsmPBj: evidence of macrophage-dependent viral amplification.
Nat. Med.
4:1401-1408[CrossRef][Medline].
|
| 18.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[CrossRef][Medline].
|
| 19.
|
Horton, R.,
P. Spearman, and L. Ratner.
1994.
HIV-2 viral protein X association with the gag p27 capsid protein.
Virology
199:453-457[CrossRef][Medline].
|
| 20.
|
Hu, W.,
N. Vander Heyden, and L. Ratner.
1989.
Analysis of the function of viral protein X (VPX) of HIV-2.
Virology
173:624-630[CrossRef][Medline].
|
| 21.
|
Hung, C.-S.,
N. Vander Heyden, and L. Ratner.
1999.
Analysis of the critical domain in the V3 loop of human immunodeficiency virus type 1 gp120 involved in CCR5 utilization.
J. Virol.
73:8216-8226[Abstract/Free Full Text].
|
| 22.
|
Imamoto, N.,
T. Tachibana,
M. Matsube, and Y. Yoneda.
1995.
A karyophilic protein forms a stable complex with cytoplasmic components prior to nuclear pore binding.
J. Biol. Chem.
270:8559-8565[Abstract/Free Full Text].
|
| 23.
|
Lewis, P. F., and M. Emerman.
1994.
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus.
J. Virol.
68:510-516[Abstract/Free Full Text].
|
| 24.
|
Lu, Y.-L.,
R. P. Bennett,
J. W. Wills,
R. Gorelick, and L. Ratner.
1995.
A leucine triple repeat sequence (LXX)4 in p6gag is important for Vpr incorporation into human immunodeficiency virus type 1 particles.
J. Virol.
69:6873-6879[Abstract].
|
| 25.
|
Lu, Y.-L.,
P. Spearman, and L. Ratner.
1993.
Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions.
J. Virol.
67:6542-6550[Abstract/Free Full Text].
|
| 26.
|
Mahalingham, S.,
V. Ayyavoo,
M. Patel,
T. Kieber-Emmons, and D. B. Weiner.
1997.
Nuclear import, virion incorporation, and cell cycle arrest/differentiation are mediated by distinct functional domains of human immunodeficiency virus type 1 Vpr.
J. Virol.
71:6339-6347[Abstract].
|
| 27.
|
Mahalingham, S.,
S. A. Khan,
M. A. Jabbar,
C. E. Monken,
R. G. Collman, and A. Srinivasan.
1995.
Identification of residues in the N-terminal acidic domain of HIV-1 vpr essential for virion incorporation.
Virology
207:297-302[CrossRef][Medline].
|
| 28.
|
Maleszka, R. A.,
A. Lupas,
S. D. Hanes, and G. L. G. Miklos.
1997.
The Dodo gene family encodes a novel protein involved in signal transduction and protein folding.
Gene
203:89-93[CrossRef][Medline].
|
| 29.
|
Moore, M. S., and G. Blobel.
1993.
The GTP-binding protein Ran/TC4 is required for protein import into the nucleus.
Nature
365:661-663[CrossRef][Medline].
|
| 30.
|
Moore, M. S., and G. Blobel.
1994.
Purification of a Ran-interacting protein that is required for protein import into the nucleus.
Proc. Natl. Acad. Sci. USA
91:10212-10216[Abstract/Free Full Text].
|
| 31.
|
Mosca, P. J.,
P. A. Dijkwel, and J. L. Hamlin.
1992.
The plant amino acid mimosine may inhibit initiation at origins of replication in Chinese hamster cells.
Mol. Cell. Biol.
12:4375-4383[Abstract/Free Full Text].
|
| 32.
|
Musacchia, A.,
M. Wilmanns, and M. Saraste.
1994.
Structure and function of the SH3 domain.
Progress Biophys. Mol. Biol.
61:283-297.
|
| 33.
|
Nakielny, S., and G. Dreyfuss.
1999.
Transport of proteins and RNAs in and out of the nucleus.
Cell
99:677-680[CrossRef][Medline].
|
| 34.
|
Pancio, H. A., and L. Ratner.
1998.
Human immunodeficiency virus type 2 Vpx-Gag interaction.
J. Virol.
72:5271-5275[Abstract/Free Full Text].
|
| 35.
|
Park, I.-W., and J. Sodroski.
1995.
Amino acid sequence requirements for the incorporation of the vpx protein of simian immunodeficiency virus into virion particles.
J. Acquir. Immune Defic. Syndr. Hum. Retrovirol.
10:506-510[Medline].
|
| 36.
|
Pirounaki, M.,
N. Vander Heyden,
M. Arens, and L. Ratner.
2000.
Rapid phenotypic drug susceptibility assay for HIV-1 with a CCR5 expressing indicator cell line.
J. Virol. Methods
85:151-161[CrossRef][Medline].
|
| 37.
|
Poiesz, B. J.,
F. W. Ruscetti,
A. F. Gazdar,
P. A. Burns,
J. D. Minna, and R. C. Gallo.
1980.
Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma.
Proc. Natl. Acad. Sci. USA
77:7415-7419[Abstract/Free Full Text].
|
| 38.
|
Popov, S.,
M. Rexach,
L. Ratner,
G. Blobel, and M. Bukrinsky.
1998.
Viral protein R regulates docking of the HIV-1 preintegration complex to the nucleus pore complex.
J. Biol. Chem.
273:13347-13352[Abstract/Free Full Text].
|
| 39.
|
Popov, S.,
M. Rexach,
G. Zybarth,
N. Reiling,
M.-A. Lee,
L. Ratner,
C. M. Lane,
M. S. Moore,
G. Blobel, and M. Bukrinsky.
1998.
Viral protein R regulates nuclear import of the HIV-1 preintegration complex.
EMBO J.
17:909-917[CrossRef][Medline].
|
| 40.
|
Radu, A.,
M. S. Moore, and G. Blobel.
1995.
The peptide repeat domain of Nup98 functions as a docking site in transport across the nuclear pore complex.
Cell
81:215-222[CrossRef][Medline].
|
| 41.
|
Rexach, M., and G. Blobel.
1995.
Protein import into nuclei: association and dissociation reactions involving transport substrate, transport factors, and nucleoporins.
Cell
83:683-692[CrossRef][Medline].
|
| 42.
|
Sharp, P. M.,
E. Bailes,
M. Stevenson,
M. Emerman, and B. Hahn.
1996.
Gene acquisition in HIV and SIV.
Nature
383:586-587[CrossRef][Medline].
|
| 43.
|
Shoya, Y.,
T. Kobayashi,
T. Koda,
K. Ikuta,
M. Kakinuma, and M. Kishi.
1998.
Two proline-rich nuclear localization signals in the amino- and carboxyl-terminal regions of the Borna disease virus phosphoprotein.
J. Virol.
72:9755-9762[Abstract/Free Full Text].
|
| 44.
|
Tristem, M.,
C. Marshall,
A. Karpas, and F. Hill.
1992.
Evolution of the primate lentiviruses: evidence from vpx and vpr.
EMBO J.
11:3405-3412[Medline].
|
| 45.
|
Vodicka, M. A.,
D. M. Koepp,
P. A. Silver, and M. Emerman.
1998.
HIV-1 vpr interacts with the nuclear transport pathway to promote macrophage infection.
Genes Dev.
12:175-185[Abstract/Free Full Text].
|
| 46.
|
Weis, K.,
I. W. Mattaj, and A. I. Lamond.
1995.
Identification of hSRP1 alpha as a functional receptor for nuclear localization sequences.
Science
268:1049-1053[Abstract/Free Full Text].
|
| 47.
|
Wu, X.,
J. A. Conway,
J. Kim, and J. C. Kappes.
1994.
Localization of the Vpx packaging signal within the C terminus of the human immunodeficiency virus type 2 Gag precursor protein.
J. Virol.
68:6161-6169[Abstract/Free Full Text].
|
| 48.
|
Yao, X.-J.,
R. A. Subbramanian,
N. Rougeau,
F. Boisvert,
D. Bergeron, and E. A. Cohen.
1995.
Mutagenic analysis of human immunodeficiency virus type 1 Vpr: role of a predicted N-terminal alpha-helical structure in Vpr nuclear localization and virion incorporation.
J. Virol.
69:7032-7044[Abstract].
|
| 49.
|
Zhou, Y.,
Y.-L. Lu, and L. Ratner.
1998.
Arginine residues in the C-terminus of HIV-1 vpr are important for nuclear localization and cell cycle arrest.
Virology
242:414-424[CrossRef][Medline].
|
Journal of Virology, July 2000, p. 6162-6167, Vol. 74, No. 13
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bergamaschi, A., Ayinde, D., David, A., Le Rouzic, E., Morel, M., Collin, G., Descamps, D., Damond, F., Brun-Vezinet, F., Nisole, S., Margottin-Goguet, F., Pancino, G., Transy, C.
(2009). The Human Immunodeficiency Virus Type 2 Vpx Protein Usurps the CUL4A-DDB1DCAF1 Ubiquitin Ligase To Overcome a Postentry Block in Macrophage Infection. J. Virol.
83: 4854-4860
[Abstract]
[Full Text]
-
Goujon, C., Arfi, V., Pertel, T., Luban, J., Lienard, J., Rigal, D., Darlix, J.-L., Cimarelli, A.
(2008). Characterization of Simian Immunodeficiency Virus SIVSM/Human Immunodeficiency Virus Type 2 Vpx Function in Human Myeloid Cells. J. Virol.
82: 12335-12345
[Abstract]
[Full Text]
-
Fujita, M., Otsuka, M., Miyoshi, M., Khamsri, B., Nomaguchi, M., Adachi, A.
(2008). Vpx Is Critical for Reverse Transcription of the Human Immunodeficiency Virus Type 2 Genome in Macrophages. J. Virol.
82: 7752-7756
[Abstract]
[Full Text]
-
Cheng, X., Belshan, M., Ratner, L.
(2008). Hsp40 Facilitates Nuclear Import of the Human Immunodeficiency Virus Type 2 Vpx-Mediated Preintegration Complex. J. Virol.
82: 1229-1237
[Abstract]
[Full Text]
-
Singhal, P. K., Rajendra Kumar, P., Subba Rao, M. R. K., Mahalingam, S.
(2006). Nuclear Export of Simian Immunodeficiency Virus Vpx Protein. J. Virol.
80: 12271-12282
[Abstract]
[Full Text]
-
Singhal, P. K., Kumar, P. R., Rao, M. R. K. S., Kyasani, M., Mahalingam, S.
(2006). Simian Immunodeficiency Virus Vpx Is Imported into the Nucleus via Importin Alpha-Dependent and -Independent Pathways. J. Virol.
80: 526-536
[Abstract]
[Full Text]
-
Rajendra Kumar, P., Singhal, P. K., Subba Rao, M. R. K., Mahalingam, S.
(2005). Phosphorylation by MAPK Regulates Simian Immunodeficiency Virus Vpx Protein Nuclear Import and Virus Infectivity. J. Biol. Chem.
280: 8553-8563
[Abstract]
[Full Text]
-
Mueller, S. M., Jung, R., Weiler, S., Lang, S. M.
(2004). Vpx proteins of SIVmac239 and HIV-2ROD interact with the cytoskeletal protein {alpha}-actinin 1. J. Gen. Virol.
85: 3291-3303
[Abstract]
[Full Text]
-
Reichert, M., Winnicka, A., Willems, L., Kettmann, R., Cantor, G. H.
(2001). Role of the Proline-Rich Motif of Bovine Leukemia Virus Transmembrane Protein gp30 in Viral Load and Pathogenicity in Sheep. J. Virol.
75: 8082-8089
[Abstract]
[Full Text]
-
Mahalingam, S., Van Tine, B., Santiago, M. L., Gao, F., Shaw, G. M., Hahn, B. H.
(2001). Functional Analysis of the Simian Immunodeficiency Virus Vpx Protein: Identification of Packaging Determinants and a Novel Nuclear Targeting Domain. J. Virol.
75: 362-374
[Abstract]
[Full Text]
-
Pancio, H. A., Vander Heyden, N., Kosuri, K., Cresswell, P., Ratner, L.
(2000). Interaction of Human Immunodeficiency Virus Type 2 Vpx and Invariant Chain. J. Virol.
74: 6168-6172
[Abstract]
[Full Text]
Top
Abstract
Text
