Previous Article | Next Article 
Journal of Virology, June 2000, p. 5075-5082, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Simian Immunodeficiency Virus Utilizes Human and Sooty
Mangabey but Not Rhesus Macaque STRL33 for Efficient
Entry
Stefan
Pöhlmann,1
Benhur
Lee,2
Silke
Meister,1
Mandy
Krumbiegel,1
George
Leslie,2
Robert W.
Doms,2 and
Frank
Kirchhoff1,*
Institute for Clinical and Molecular
Virology, University of Erlangen-Nürnberg, 91054 Erlangen,
Germany,1 and Department of
Pathology and Laboratory Medicine, University of Pennsylvania,
Philadelphia, Pennsylvania 191042
Received 5 January 2000/Accepted 7 March 2000
 |
ABSTRACT |
It has been established that many simian immunodeficiency virus
(SIV) isolates utilize the orphan receptors GPR15 and STRL33 about as
efficiently as the chemokine receptor CCR5 for entry into target cells.
Most studies were performed, however, with coreceptors of human
origin. We found that SIV from captive rhesus macaques (SIVmac) can
utilize both human and simian CCR5 and GPR15 with comparable
efficiencies. Strikingly, however, only human STRL33
(huSTRL33), not rhesus macaque STRL33 (rhSTRL33), functioned efficiently as an entry cofactor for a variety of isolates of SIVmac
and SIV from sooty mangabeys. A single amino acid substitution of S30R in huSTRL33 impaired coreceptor activity, and the reverse change in rhSTRL33 greatly increased coreceptor activity. In
comparison, species-specific sequence variations in N-terminal
tyrosines in STRL33 had only moderate effects on SIV entry. These
results show that a serine residue located just outside of the cellular
membrane in the N terminus of STRL33 is critical for SIV coreceptor
function. Interestingly, STRL33 derived from sooty mangabeys, a
natural host of SIV, also contained a serine at the corresponding
position and was used efficiently as an entry cofactor. These results
suggest that STRL33 is not a relevant coreceptor in the
SIV/macaque model but may play a role in SIV replication and
transmission in naturally infected sooty mangabeys.
| |
INTRODUCTION |
Simian immunodeficiency virus (SIV)
from captive rhesus macaques (SIVmac) and human immunodeficiency virus
type 2 (HIV-2) show a high degree of genetic homology to SIV in
naturally infected sooty mangabeys (SIVsm), suggesting that
both originated from SIVsm by cross-species transmission (35,
36). SIV and HIV-2 show many similarities to HIV-1, the etiologic
agent of AIDS (11, 49). SIVsm causes a persistent but
asymptomatic infection in its natural African host (55).
HIV-2 is pathogenic in humans, but infected individuals exhibit long
clinical latency periods and progress slowly toward AIDS (18,
49). In contrast, SIVmac-infected rhesus macaques
frequently develop an AIDS-like disease within the first year
after infection (17, 40, 45). Therefore, infection of
macaques with SIVmac represents the most commonly used animal
model for the study of AIDS pathogenesis, therapy, and vaccine
development (21, 39).
Entry of both HIV and SIV into target cells usually involves the
binding of the external envelope glycoprotein (gp120) to the cellular
CD4 receptor molecule and subsequent interactions with seven
transmembrane-spanning G-protein-coupled chemokine receptors (7TM
GPCRs), which mediate fusion between the viral and host cell membrane
(reviewed in references 8, 9, 22, 51, and
68). CCR5 and CXCR4 are the major HIV-1 coreceptors (2, 15, 19, 23, 24, 34). HIV-2 isolates are less restricted
to CXCR4 and CCR5 and frequently utilize additional coreceptors
(13, 54, 57). In contrast to both HIV-1 and HIV-2, SIV
isolates use CCR5 but usually not CXCR4 for viral entry (12, 13,
37, 41, 48), although macaque- and mangabey-derived CXCR4
is fully functional for HIV-1 entry (12). The unique
exception is SIV from red-capped mangabeys, which uses CCR2B
(14). Interestingly, many red-capped mangabeys lack
CCR5 due to a naturally occurring polymorphism.
In addition to CCR5, a variety of chemokine and orphan receptors, such
as CCR8, GPR15, STRL33, GPR1, ChemR23, and APJ, have been proposed as
alternative coreceptors for SIV (3, 16, 20, 28, 29, 31, 38, 46,
47, 65, 66). Of these, GPR15 (also named BOB) and STRL33 (also
named Bonzo) may be of particular importance in the SIV/macaque model,
because both are used nearly as efficiently as CCR5 by many SIV
isolates (20, 28, 31). STRL33 was identified as an entry
cofactor by two independent approaches: degenerate PCR from a
tumor-infiltrating cell line (TIL 9) (46) and a
functional-expression screening assay for SIV entry cofactors
(20). Efficient utilization of STRL33 by HIV-1 is rare and
usually only observed at high expression levels (59, 67,
69-71). Interestingly, however, in a case of vertical mother-child transmission of HIV-1, viral isolates from the infant as well as from the mother efficiently used STRL33 for entry
(70, 71). The CCR5-, CXCR4-, and STRL33-tropic maternal isolate infected STRL33+, CCR5
peripheral blood lymphocytes in the presence of a CXCR4 antagonist, suggesting that STRL33 can mediate HIV-1 entry into primary cells (66a). HIV-2 isolates obtained from patients diagnosed with
AIDS frequently and efficiently utilize a broad range of coreceptors, including both STRL33 and GPR15 (13, 54, 57). Blocking
experiments suggest that coreceptors other than CCR5 or CXCR4 can
mediate HIV-2 replication in primary cells, and it has been proposed
that an expanded coreceptor tropism of HIV-2 might correlate with
increased pathogenesis (57).
Both GPR15 and STRL33 are expressed by primary cells and in lymphoid
tissues and could contribute to viral spread in vivo (20,
66a). The accumulated in vitro data suggest that GPR15 and STRL33
might play a more important role in the pathogenesis of SIV and HIV-2
than in that of HIV-1. Studies on their in vivo relevance, however, are
limited. Apparently, utilization of GPR15 in addition to CCR5 does not
provide a major advantage for SIV replication in vivo (61).
Most of the studies on SIV entry were performed with 7TM GPCRs of
human origin. It has been shown, however, that SIVmac
utilizes rhesus CCR5 more efficiently than human CCR5 in the absence of CD4 (30). In the present study we investigated whether SIV
coreceptor function of GPR15 and STRL33 is species dependent. We show
that SIVmac efficiently utilizes human-derived and rhesus
macaque-derived CCR5 and GPR15. Unexpectedly, however, human STRL33
(huSTRL33) was used with much higher efficiency as an entry
cofactor than rhesus macaque STRL33 (rhSTRL33). This striking
result implies that utilization of STRL33 does not play an important
role in SIVmac replication in infected rhesus macaques. In
contrast, sooty mangabey STRL33 (smSTRL33) was used efficiently
by both SIVmac and SIVsm isolates, suggesting that it may be
a relevant coreceptor in naturally infected sooty mangabeys.
| |
MATERIALS AND METHODS |
Coreceptor expression vectors.
pBabe-puro vectors expressing
human and rhesus macaque CCR5 were provided by Nathaniel Landau and
Preston Marx through the AIDS Research and Reference Program, Division
of AIDS, National Institute of Allergy and Infectious Diseases.
Expression vectors for human GPR15 and STRL33 were kindly provided by
Dan Littman (Skirball Institute for Molecular Medicine, New York,
N.Y.). Vectors expressing rhesus macaque GPR15 were generated as
described previously (60). To generate plasmids expressing
rhSTRL33, RNA was isolated from rhesus macaque peripheral blood
mononuclear cells (PBMC) or the herpesvirus saimiri-transformed rhesus
macaque T-cell line 221 (1). cDNA was prepared using an
avian myeloblastosis virus reverse transcriptase-based cDNA synthesis
kit (Boehringer Mannheim). Primers used for PCR amplification of STRL33
were p5STRL33-comp (5'-CCGGATCCGGTGTTCATCAGAACAGACACCATG-3') and
p3STRL33-comp
(5'-CCGAATTCTTTCGAAACCCTGGCAAGGCCT-3'). The
indicated BamHI and EcoRI restriction sites
(underlined) were used for cloning into the pBABE-puro expression
vector. The rhSTRL33 amino acid sequences derived from 221 cells and
rhesus macaque PBMC were identical to each other and to GenBank
sequence AF124380.
smSTRL33 was amplified by PCR from PBMC-derived genomic DNA from three
mangabeys using primers p5outSTRL33
(5'-CCAAATATAATTCCTGGGTTCTGACTC-3') and p3outSTRL33
(5'-GCCATGCCTTGCAAATTCCAGAGCAG-3'). The resulting 1.1-kb
amplification products were cloned into the TA cloning vector pCR2.1
(Invitrogen, Carlsbad, Calif.). DNA fragments were excised by
EcoRI digestion and cloned into the EcoRI site of
the pBABE-puro expression vector. Clones harboring the insert in the correct orientation were identified by restriction analysis. Sequence analysis revealed that clones derived from all animals contained identical inserts representing intact smSTRL33 open reading frames.
Mutagenesis of STRL33.
Most STRL33 mutants were generated by
PCR mutagenesis using oligonucleotides which introduced nucleotide
changes close to the 5' end and added an AU-1 tag to the 3' end of the
STRL33 coding sequence. The R31S change in rhSTRL33 and the S30R change
in huSTRL33 were introduced by overlap extension PCR. For rhSTRL33, the
5' PCR fragment was generated using p5STRL33-comp and p3rhBZ-RS
(5'-TTGCTGAACTGCAGGAAGT-3') and the 3' PCR fragment was
generated using p5rhBZ-RS (5'-TTCCTGCAGTTCAGCAAGGTCTTTCTGCC-3') and p3STRL33AU1
(5'-CCG AATTCCTAATGTATCTGTAGGTGTCTAACTGGAACATGCTGGTGGC C-3').
Both fragments were gel purified and used as the template in a
second PCR with p5STRL33-comp and p3STRL33AU1. The S30R mutation was
introduced using the same approach, except that oligonucleotides corresponding to the huSTRL33 sequence were used. All PCR-derived fragments were sequenced to ensure that only the intended changes were present.
Virus stocks.
Generation of virus stocks was performed by
the calcium phosphate method essentially as described previously
(19). Briefly, 293T cells were transfected with 10 µg of
the full-length proviral SIVmac239 harboring the luciferase
gene in place of nef or cotransfected with 10 ng of an
env-defective reporter virus (41, 66a) and 5 µg
of envelope expression vectors. After overnight incubation the medium
was changed and virus was harvested 24 h later. Viral stocks were
aliquoted and frozen at 
80°C, and p27 antigen concentrations of
viral stocks were quantitated with an SIV p27 antigen capture enzyme-linked immunosorbent assay kit obtained through the National Institutes of Health AIDS Research and Reference Reagent Program.
Cell culture.
293T cells were grown in Dulbecco modified
Eagle medium supplemented with 10% fetal calf serum (FCS) and
antibiotics. 221 cells were maintained in RPMI 1640 medium containing
20% FCS, 100 U of interleukin-2/ml, and antibiotics as described
previously (1).
Entry assays.
To determine coreceptor activity of the STRL33
mutants, 293T cells were transiently cotransfected with CD4 and
coreceptor expression plasmids. After overnight incubation the medium
was changed and the cells were seeded in 48-well dishes. The following day, cells were infected with 50 ng of luciferase reporter virus (41, 60) in a total volume of 0.5 ml. At 3 days after
infection cells were lysed, and the luciferase activities in 20-µl
cell lysate samples were determined using a commercially available kit
(Promega). For infection with green fluorescent protein (GFP) reporter
viruses (Sharron et al., submitted), 293T cells were seeded in 12-well
dishes. After overnight incubation, cells were cotransfected with CD4
and coreceptor expression plasmids. The following day, cells were
infected with GFP reporter virus containing 100 ng of p27 antigen in a
total volume of 1 ml. Three days after infection cells were detached
from the plates, washed and fixed with 2% paraformaldehyde and the
percentage of GFP-positive cells was analyzed by fluorescence-activated
cell sorting (FACS).
Western blot analysis.
293T cells were cotransfected with 10 µg of STRL33 vectors containing a C-terminal AU1 tag. After overnight
incubation the medium was replaced by fresh Dulbecco modified Eagle
medium. Cells were harvested 48 h after transfection and lysed
with lysis buffer (0.5% Nonidet P-40, 0.15 M NaCl, 50 mM HEPES buffer
[pH 7.5]) containing 10 mM NaF and 1 mM phenylmethylsulfonyl fluoride
(Sigma Chemicals, St. Louis, Mo.). Expression of STRL33 in cleared
lysates was analyzed by immunoblotting. Proteins were detected with a 1:10,000 dilution of anti-AU1 antibody (Babco, Richmond, Calif.).
Epitope mapping.
The STRL33-specific monoclonal antibody
(MAb) 699 (mouse anti-STRL33 clone 56811; R&D Systems, Minneapolis,
Minn.) was generated as described previously (43, 66a). For
epitope mapping 293T cells were seeded in 12-well dishes and
transiently transfected with the various STRL33 expression vectors on
the following day. At 18 h after transfection, cells were detached
from the plate with 5 mM EDTA and stained with phycoerythrin-conjugated
anti-STRL33 MAb 699 (66a). FACS analysis was performed
essentially as described previously (44, 66a).
Nucleotide sequence accession number.
The smSTRL33
nucleotide sequence has been assigned GenBank accession no. AF237559.
| |
RESULTS |
SIVmac efficiently infects cells expressing huSTRL33 but
not rhSTRL33.
SIVmac239 is a
well-characterized pathogenic molecular clone (40, 62) which
has been used in many studies on the pathogenesis of primate
lentiviruses and on vaccine development. It has been previously shown
that SIVmac239 enters efficiently into macrophages but
produces only very small amounts of progeny virus (52, 53). SIVmac239 uses both macaque and human CCR5 (12, 41,
48) and human-derived GPR15 and STRL33 (20, 28, 31).
To investigate if the coreceptor tropism of SIVmac239 is
species dependent, 293T cells were cotransfected with expression
plasmids for CD4 and entry cofactor CCR5, GPR15, or STRL33 of both
human and rhesus macaque origin. Subsequently, the cells were infected
with replication-competent SIVmac239 carrying the luciferase
reporter gene in place of the nef gene. A chimeric SIV with
the env gene of an amphotropic murine leukemia virus named
MuSIV-Luc (63) served as a positive control. MuSIV-Luc
efficiently infected cells independently of CD4 or coreceptor expression (Fig. 1 and data not shown). In contrast, no luciferase activities were detected after infection with env-defective
SIVmac239. SIVmac239 entered efficiently into cells
expressing both human- and rhesus macaque-derived CCR5 and GPR15 (Fig.
1). Entry efficiencies observed with
huSTRL33 were comparable to those observed with CCR5 and
GPR15. Unexpectedly, however, about 13-fold-reduced entry levels were
measured with cells expressing rhSTRL33 (Fig. 1).
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
SIVmac239 does not use rhSTRL33 for
efficient entry. 293T cells were cotransfected with plasmids expressing
human or macaque CD4 and the indicated entry cofactors of human and
rhesus macaque origin. At 1 day posttransfection the cells were
detached from the plates, seeded in 48-well dishes, and infected in
triplicate with intact luciferase reporter viruses containing 50 ng of
p27 antigen. Luciferase activities in the cellular extracts were
measured at 3 days postinfection. Error bars give standard deviations
from average values measured in three independent infections. Similar
results were obtained in three additional experiments. As controls the
transfected cells were infected with envelope-deleted
SIVmac239 ( env) or with a chimeric SIV containing the
murine leukemia virus glycoprotein (MuSIV) (63). Luciferase
values obtained with rhSTRL33 (1,885 ± 61) were about
13-fold lower than those obtained with huSTRL33 (24,043 ± 2,993).
|
|
The failure of rhSTRL33 to support efficient SIV infection
could be due to structural differences between the rhesus macaque
and
human receptors or to inefficient expression of rhSTRL33.
Therefore, we investigated if expression levels contributed to
the
different entry efficiencies. Since our
anti-huSTRL33-specific
MAb does not cross-react with
rhSTRL33 (
66a), an AU1 tag was
added to the C
termini of the human and rhesus macaque proteins.
We found that the AU1
tag did not impair the ability of huSTRL33
to function as an
entry cofactor for SIVmac239 (Fig.
2A). However,
similar to the results
obtained with untagged rhSTRL33, about
25-fold-lower
entry efficiencies were observed with AU1-tagged
rhSTRL33.
Western blot analysis revealed that huSTRL33 and
rhSTRL33
proteins were expressed with comparable efficiencies
(Fig.
2B).
Therefore, species-specific differences rather than
expression
levels accounted for the failure of rhSTRL33 to
support efficient
SIV infection.
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Different SIV entry efficiencies are not due to
inefficient expression of rhSTRL33. (A) 293T cells were
cotransfected with CD4 and expression constructs for wild-type and
AU1-tagged huSTRL33 and rhSTRL33.
SIVmac239 entry was determined as described in the legend to
Fig. 1. The results represent average values of three independent
infections. (B) 293T cells were transfected with vectors expressing
AU1-tagged huSTRL33 or rhSTRL33. Protein expression
was verified by Western blot analysis as described in Materials and
Methods. Control, cell extracts derived from mock-transfected 293T
cells.
|
|
Variations in the N terminus of STRL33 determine SIVmac
coreceptor function.
It was unexpected that SIVmac239
was impaired in the utilization of STRL33 derived from its host, the
rhesus macaque, but was capable of using huSTRL33 for
efficient entry. Sequence alignments revealed that huSTRL33
and rhSTRL33 show 94% amino acid identity. As shown in Fig.
3 the extracellular sequences of both
orphan receptors differ at seven amino acid positions close to the N terminus and in a single residue in each of the three extracellular loops. As a first step to elucidate which specific amino acid variations were responsible for the species specificity of STRL33 coreceptor usage, we generated two AU1-tagged recombinants between huSTRL33 and rhSTRL33 (Fig.
4A). Exchanging the first 64 amino acids
of huSTRL33 for the corresponding rhesus macaque-derived sequences impaired coreceptor function. The reciprocal construct, in
which the N-terminal 64 amino acids of huSTRL33 were
introduced into rhSTRL33, conferred full activity to
rhSTRL33 (Fig. 4B). Western blot analysis revealed that both
chimeric proteins were expressed equally well (data not shown). Thus,
sequence variations close to the N terminus of STRL33 determined
coreceptor activity.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Schematic presentation of the N-terminal region and the
extracellular domains of rhSTRL33. Amino acid variations in
huSTRL33 compared to the rhSTRL33 sequence are
indicated. huSTRL33 and rhSTRL33 are 94% identical
at the amino acid level, with most differences clustered at the amino
terminus (20, 46). Differences between huSTRL33
and rhSTRL33 are indicated by the shaded residues. The
numbers give the amino acid positions in rhSTRL33. Bar, cell
membrane.
|
|
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Species-specific sequence variations in the N terminus
of STRL33 determine SIV coreceptor function. (A) Schematic presentation
of the AU1-tagged STRL33 recombinants with an huSTRL33 N
terminus and a rhSTRL33 C terminus (huN/rhC) and with an
rhSTRL33 N terminus and an huSTRL33 C terminus
(rhN/huC). (B) 293T cells were cotransfected with CD4 and expression
constructs for the indicated STRL33 variants. SIVmac239 entry
was tested as described in the legend to Fig. 1. The results represent
average values of three independent infections. Control, cell extracts
derived from mock-transfected 293T cells.
|
|
Amino acid variation S31R determines STRL33 function as an SIV
entry cofactor.
The N-terminal region of STRL33 which determines
coreceptor function contains seven amino acid variations between the
human and rhesus macaque orphan receptors (Fig. 3). Among these are substitutions in several tyrosine residues (H4Y, Y6H, H7Y, and Y10D).
It has been previously shown that N-terminal tyrosines are important
for CCR5 coreceptor function (32, 33).
To map the specific amino acid residues that determined SIV
coreceptor activity, a variety of AU1-tagged mutants of both
rhSTRL33
and huSTRL33 were analyzed (Fig.
5). Changes of Y4H, H6Y, Y7H,
D10Y,
L13
, and S14N in rhSTRL33 did not significantly
increase
its functional activity as an SIV coreceptor (Fig.
5, upper
panel).
In contrast, the R31S substitution resulted in entry
efficiencies
comparable to those observed with huSTRL33. The
reverse substitutions
in huSTRL33 confirmed the importance of
the S31R substitution
for coreceptor function: changes of H4Y,
Y6H, H7Y, and Y10D had
only moderate effects, whereas the S30R mutation
resulted in about
20-fold-reduced activity, comparable to that with
rhSTRL33 (Fig.
5, lower panel). Western blot analysis
revealed that, with the
exception of the inactive
Nter
huSTRL33 variant, all mutated
coreceptors were expressed
with comparable efficiencies (data
not shown). Thus, the R31S
substitution located just outside of
the first transmembrane domain
(Fig.
3) determined the differential
coreceptor activities of
huSTRL33 and rhSTRL33.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Amino acid substitution of S31R impairs functional
activity of rhSTRL33 as an SIVmac239 entry
cofactor. Mutational analysis of rhSTRL33 and
huSTRL33. The specific mutations compared to the original
rhSTRL33 and huSTRL33 amino acid sequences are
shown at the left. Dashes indicate amino acid identity, and dots
indicate gaps. The relative entry efficiencies compared to human STRL33
are shown at the right. Average values from three infections are shown,
and comparable results were obtained with independent virus stocks.
|
|
Several additional SIV envelopes were tested to exclude the possibility
that the inefficient usage of rhSTRL33 as a coreceptor
is
specific for the SIVmac239 molecular clone.
SIVmac316 is a
derivative of SIVmac239 that
replicates with high efficiency in
alveolar macrophages (
52,
53). It has been shown that macrophage-
and T-cell-tropic SIV
isolates interact differently with CCR5
(
26).
Consistent with the results obtained with SIVmac239,
luciferase
reporter viruses pseudotyped with the SIVmac316
envelope entered
cells expressing huSTRL33 with higher
efficiency than that with
which they entered cells expressing
rhSTRL33 (data not shown).
Similar results were obtained with
GFP reporter viruses pseudotyped
with envelopes from
SIVmacBK28, which was derived from SIVmac251
after
propagation on the human T-cell line H9 (
56); SIVsm
B670
cl.3, from transplacentally infected macaque infants (
4);
and
the neurovirulent SIVmac17E/Fr strain (
5,
27).
The absolute
number of GFP-positive cells coexpressing CD4 and
huSTRL33 varied
from 11.6% (SIVmacBK28) to 2.9%
(SIVsm
B670 cl.3) to 0.8% (SIVmac17E/F).
For all
three envelopes the number of GFP-positive cells was 10-
to 50-fold
lower after transfection with rhSTRL33 (Fig.
6). Similar
to the results obtained with
SIVmac239 (Fig.
5), changes of H4Y,
Y6H, H7Y, and Y10D close
to the N terminus of huSTRL33 reduced
coreceptor function
only two- to fourfold (hu-mutNter; Fig.
6).
In comparison, the S30R
mutation in huSTRL33 had strongly disruptive
effects and,
conversely, the single R31S substitution in rhSTRL33
imparted coreceptor activity that was equivalent to that observed
with huSTRL33 (Fig.
6). SIVsm
B670 cl.3 and
SIVmac17E/F entered
cells transfected with the
huNter/ rhCter-STRL33 construct about
two- to threefold more
efficiently than cells transfected with
the huSTRL33
expression vector. This indicates that variations
in the three
extracellular domains also contribute to STRL33 function
as an SIV
coreceptor. Nonetheless, the serine residue located
just outside of the
first transmembrane domain was clearly identified
as the key residue
for STRL33 coreceptor activity. We previously
reported on the
expression and coreceptor activity of STRL33 on
human peripheral blood
lymphocytes using a MAb against huSTRL33
(
66a). We
found that MAb 699 was unable to recognize rhSTRL33
and
to block viral infection via huSTRL33 (
66a). FACS
analysis
revealed that the epitope of MAb 699 maps to the N terminus of
STRL33 but does not include the serine residue crucial for
STRL33's
coreceptor activity (data not shown). This likely accounts
for
its inability to block infection via huSTRL33. Since this
MAb
does not react in Western blot analysis, it probably recognizes
a
discontinuous or conformational epitope present in the N terminus
of
cell surface-associated huSTRL33.
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
Serine 31 is critical for STRL33 coreceptor function of
several SIV isolates. SIVmacBK28, SIVsmB670 cl.3, and
SIVmac17E/F Env-pseudotyped GFP reporter viruses were used to
infect cells coexpressing CD4 and the indicated STRL33 variants.
Infection efficiency (percentage of GFP-positive cells) is shown
relative to that obtained for huSTRL33 (100%). Comparable
results were obtained in two independent experiments.
|
|
smSTRL33 is efficiently used as an SIV coreceptor.
Both HIV-2
and SIVmac originate from sooty mangabeys
naturally infected in west Africa (35, 36). To
investigate whether STRL33 might play a role in SIV replication
in mangabeys, we amplified the STRL33 open reading frame from
three different animals by PCR. The predicted smSTRL33 amino acid
sequence differed at a total of 19 positions (H4Y, Y6H, H7Y,
Y10D, G11E, 13F, S14N, E22K, V97I, S105T, I109V, T152I,
S153C, G182R, A187E, M246T, M251V, F253L, M272I) from the
huSTRL33 sequence. Overall, the N-terminal region of smSTRL33
showed higher sequence similarity to rhSTRL33 than to
huSTRL33. For example, the location of N-terminal
tyrosines was well conserved between STRL33 derived from both monkey
species (Fig. 7A). Similar to
huSTRL33, however, smSTRL33 contained a serine at amino acid
position 31 (Fig. 7A). Functional analysis revealed that
luciferase reporter viruses pseudotyped with the SIVmac239,
SIVmac316, and SIVsmB670 cl.3 envelopes entered
cells expressing smSTRL33 or huSTRL33 with comparable
efficiencies (Fig. 7B). The coreceptor activity of smSTRL33 indicates
that it may be a relevant entry cofactor in naturally infected
mangabeys and further supports the critical role of the serine
residue for STRL33 coreceptor function.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
smSTRL33 mediates efficient SIV entry. (A) Sequence
variations at the N terminus of STRL33 derived from humans (hu), rhesus
macaques (rh), sooty mangabeys (sm), pig tail macaques (ptm),
and African green monkeys (agm) (20, 46). Dashes, identity
with the human-derived STRL33 sequence; dots, gaps introduced to
optimize the alignment. The position of the serine residue, which is
critical for STRL33 coreceptor function, is boxed. (B) Entry of
luciferase reporter viruses pseudotyped with SIVmac239,
SIVmac316, and SIVsmB670 cl.3 Env into cells coexpressing
CD4 and smSTRL33. Infections were performed as indicated in Materials
and Methods. Entry efficiency is shown relative to that obtained for
huSTRL33. Data represent average values obtained for three
independent infections. Control, cell extracts derived from
mock-transfected 293T cells infected with pseudotyped luciferase
reporter viruses.
|
|
| |
DISCUSSION |
In this study, we show that several SIVmac and SIVsm
isolates use huSTRL33 and smSTRL33 as an entry cofactor with
much higher efficiency than they use rhSTRL33. The functional
differences mapped to the N terminus of STRL33, which differs at seven
positions between human and rhesus macaque-derived coreceptors:
H4Y, Y6H, H7Y, Y10D, 13L, N14S, and S31R (Fig. 3). Mutational
analysis revealed that the S31R amino acid variation was of critical
importance for coreceptor activity, irrespective of the SIV isolate
tested. In comparison, sequence variations in N-terminal tyrosine
residues between rhSTRL33 and huSTRL33 had only
moderate effects.
huSTRL33 is efficiently used by many SIV isolates derived
from infected rhesus macaques, and it has been suggested that this entry cofactor might play a role in the pathogenesis of primate lentiviruses (20, 31). Therefore, it was striking that
rhSTRL33 was used very inefficiently compared to
huSTRL33. Analysis of AU1-tagged orphan receptors
revealed that huSTRL33 and rhSTRL33 were
expressed with comparable efficiencies. Thus, the specific amino acid
variations close to the N terminus of STRL33, and not different
expression levels, determined coreceptor function. The finding that
differences in N-terminal sequences had a dramatic effect on the
coreceptor function of STRL33 is in agreement with previous studies on
CCR5 coreceptor function (6, 25, 32, 61, 64). The N-terminal
regions of SIV and HIV entry cofactors contain several tyrosines and
acidic amino acid residues which are involved in coreceptor activity,
and it has been suggested that tyrosine sulfation of the N terminus of
CCR5 is important for HIV-1 entry (32, 33). Similarly to
CCR5, both huSTRL33 and rhSTRL33 contain several
acidic residues and two tyrosines close to the N terminus. The
tyrosines are located at positions 6 and 10 in huSTRL33 and
at positions 4 and 7 in rhSTRL33 (Fig. 3). These variations
in the acidic and tyrosine-rich region, however, had only moderate
effects on coreceptor activity. In comparison, an S30R substitution in
huSTRL33 impaired coreceptor activity and the reverse R31S
change in rhSTRL33 greatly increased coreceptor activity.
Serine residues are also present at the N termini of several other
coreceptors, and it has been shown that serine 17 in CCR5 is also
important for viral entry (61). Therefore, serine residues
may contribute to the coreceptor function of several 7TM GPCRs.
Overall, primate coreceptors are highly conserved, and usually the
sequences derived from nonhuman primates and the corresponding human
genes show 
94% homology (7, 10, 50). However, most of the
differences are usually found in the N termini of the 7TM GPCRs. Some
N-terminal sequence variations which could potentially influence
coreceptor function are also found in the major HIV and SIV entry
cofactors, CCR5 and CXCR4, derived from different primate species
(7, 10, 72). The finding that rhSTRL33 was used
much less efficiently than huSTRL33 underlines the importance of using coreceptors derived from the appropriate species when studying
coreceptor tropism of primate lentiviruses. STRL33 derived from humans,
sooty mangabeys, and African green monkeys (Cercopithecus aethiopis) contain a serine residue at position 31, whereas both Macaca mulatta and Macaca nemestrina contain an
arginine at the corresponding position (Fig. 7A). African green monkey
SIV (SIVagm) can use huSTRL33 (50), and it is
possible that STRL33 is a relevant entry cofactor of the SIVagm group
of primate lentiviruses. SIVmac and SIVsm do not utilize
rhSTRL33 for efficient entry, and the S31R sequence variation
that impaired coreceptor function is found in both M. mulatta- and M. nemestrina-derived STRL33. These
results suggest that STRL33 is not of major importance for SIV
replication and pathogenicity in experimentally infected macaques.
These findings clearly do not rule out the possibility that STRL33
plays an important role in certain aspects of SIV and HIV pathogenicity
and transmission. Our results also show that smSTRL33 is an efficient
coreceptor for SIV, indicating that this orphan receptor might
contribute to viral replication in naturally infected
mangabeys. Recent results suggest that some HIV-1 isolates
might utilize STRL33 as a coreceptor on primary cells (66a).
HIV-1 isolates derived from a mother-infant pair efficiently used
STRL33 (70, 71), suggesting that this orphan receptor might
play a role in vertical HIV-1 transmission. Furthermore, STRL33 was
used relatively frequently by lung lymphocyte-derived clones isolated
from one HIV-1-infected patient (67). The exact role of
STRL33 in the pathogenesis of primate immunodeficiency viruses,
however, remains to be elucidated.
In summary, our findings suggest that STRL33 is not an important
coreceptor in the SIV/macaque model but may play a role in naturally
infected sooty mangabeys. Coreceptor expression levels are
important for efficient viral entry (42, 44, 58). Recent findings suggest that STRL33 requires higher expression levels than
CCR5 for mediating infection (44, 59, 66a). Importantly, rhSTRL33 was inefficient in mediating SIV entry even in
transiently transfected 293T cells that express very high STRL33
levels. Recently, it has been shown that GPR15 coreceptor usage in
addition to CCR5 is of limited relevance for SIV replication in vivo
(60). Taken together these results underline the central
importance of CCR5 as a cofactor for SIV entry. Additional studies are
required, however, to clarify if viral replication via these
alternative receptors might induce immunodeficiency when CCR5 and CXCR4
are efficiently blocked.
| |
ACKNOWLEDGMENTS |
A number of reagents were obtained through the AIDS Research and
Reference Reagents Program, Division of AIDS, NIAID, NIH. We thank
Bernhard Fleckenstein for constant support and encouragement. We also
thank Toshiaki Kodama for the full-length SIVmac239 clone.
This work was supported by the Deutsche Forschungsgemeinschaft (SFB
466) and the Johannes and Frieda Marohn Foundation. B.L. was supported
by a K08 grant from the National Heart, Lung, and Blood Institute
(HL03923-01) and the Measey Foundation Fellowship for Clinicians
(Wistar Institute). R.W.D. is an Elizabeth Glazer Scientist of the
Pediatric AIDS Foundation and was supported by National Institutes of
Health grant R01 40880 and by a Burroughs Wellcome Fund award for
translational research.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute for
Clinical and Molecular Virology, University of Erlangen-Nürnberg,
Schlossgarten 4, 91054 Erlangen, Germany. Phone: 49-9131-852-6483. Fax:
49-9131-85-1002. E-mail:
fkkirchh{at}viro.med.uni-erlangen.de.
| |
REFERENCES |
| 1.
|
Alexander, L.,
Z. Du,
M. Rosenzweig,
J. J. Jung, and R. C. Desrosiers.
1997.
A role for natural simian immunodeficiency virus and human immunodeficiency virus type 1 nef alleles in lymphocyte activation.
J. Virol.
71:6094-6099[Abstract].
|
| 2.
|
Alkhatib, G.,
C. Combadiere,
C. C. Broder,
Y. Feng,
P. E. Kennedy,
P. M. Murphy, and E. A. Berger.
1996.
CC-CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 3.
|
Alkhatib, G.,
F. Liao,
E. A. Berger,
J. M. Farber, and K. W. Peden.
1997.
A new SIV co-receptor, STRL33.
Nature
388:238[CrossRef][Medline].
|
| 4.
|
Amedee, A. M.,
N. Lacour,
J. L. Gierman,
L. N. Martin,
J. E. Clements,
R. Bohm, Jr.,
R. M. Harrison, and M. Murphey-Corb.
1995.
Genotypic selection of simian immunodeficiency virus in macaque infants infected transplacentally.
J. Virol.
69:7982-7990[Abstract].
|
| 5.
|
Anderson, M. G.,
D. Hauer,
D. P. Sharma,
S. V. Joag,
O. Narayan,
M. C. Zink, and J. E. Clements.
1993.
Analysis of envelope changes acquired by SIVmac239 during neuroadaption in rhesus macaques.
Virology
195:616-626[CrossRef][Medline].
|
| 6.
|
Atchison, R. E.,
J. Gosling,
F. S. Monteclaro,
C. Franci,
L. Digilio,
I. F. Charo, and M. A. Goldsmith.
1996.
Multiple extracellular elements of CCR-5 and HIV-1 entry: dissociation from response to chemokines.
Science
274:1924-1926[Abstract/Free Full Text].
|
| 7.
|
Benton, P. A.,
D. R. Lee, and R. C. Kennedy.
1998.
Sequence comparisons of non-human primate HIV-1 coreceptor homologues.
Mol. Immunol.
35:95-101[CrossRef][Medline].
|
| 8.
|
Berger, E. A.,
P. M. Murphy, and J. M. Farber.
1999.
Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease.
Annu. Rev. Immunol.
17:657-700[CrossRef][Medline].
|
| 9.
|
Bieniasz, P. D., and B. R. Cullen.
1998.
Chemokine receptors and human immunodeficiency virus infection.
Front. Biosci.
3:44-58.
|
| 10.
|
Carrington, M.,
T. Kissner,
B. Gerrard,
S. Ivanov,
S. J. O'Brien, and M. Dean.
1997.
Novel alleles of the chemokine-receptor gene CCR5.
Am. J. Hum. Genet.
61:1261-1267[CrossRef][Medline].
|
| 11.
|
Chakrabarti, L.,
M. Guyader,
M. Alizon,
M. D. Daniel,
R. C. Desrosiers,
P. Tiollais, and P. Sonigo.
1987.
Sequence of simian immunodeficiency virus from macaque and its relationship to other human and simian retroviruses.
Nature
328:543-547[CrossRef][Medline].
|
| 12.
|
Chen, Z.,
P. Zhou,
D. D. Ho,
N. R. Landau, and P. A. Marx.
1997.
Genetically divergent strains of simian immunodeficiency virus use CCR5 as a coreceptor for entry.
J. Virol.
71:2705-2714[Abstract].
|
| 13.
|
Chen, Z.,
A. Gettie,
D. D. Ho, and P. A. Marx.
1998.
Primary SIVsm isolates use the CCR5 coreceptor from sooty mangabeys naturally infected in west Africa: a comparison of coreceptor usage of primary SIVsm, HIV-2, and SIVmac.
Virology
246:113-124[CrossRef][Medline].
|
| 14.
|
Chen, Z.,
D. Kwon,
Z. Jin,
S. Monard,
P. Telfer,
M. S. Jones,
C. Y. Lu,
R. F. Aguilar,
D. D. Ho, and P. A. Marx.
1998.
Natural infection of a homozygous delta 24 CCR5 red-capped mangabey with an R2b-tropic simian immunodeficiency virus.
J. Exp. Med.
188:2057-2065[Abstract/Free Full Text].
|
| 15.
|
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P. D. Ponath,
L. Wu,
C. R. Mackay,
G. LaRosa,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1996.
The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135-1148[CrossRef][Medline].
|
| 16.
|
Choe, H.,
M. Farzan,
M. Konkel,
K. Martin,
Y. Sun,
L. Marcon,
M. Cayabyab,
M. Berman,
M. E. Dorf,
N. Gerard,
C. Gerard, and J. Sodroski.
1998.
The orphan seven-transmembrane receptor Apj supports the entry of primary T-cell-line-tropic and dualtropic human immunodeficiency virus type 1.
J. Virol.
72:6113-6118[Abstract/Free Full Text].
|
| 17.
|
Daniel, M. D.,
N. L. Letvin,
N. W. King,
M. Kannagi,
P. K. Sehgal,
R. D. Hunt,
P. J. Kanki,
M. Essex, and R. C. Desrosiers.
1985.
Isolation of T-cell tropic HTLV-III-like retrovirus from macaques.
Science
228:1201-1204[Abstract/Free Full Text].
|
| 18.
|
De Cock, K. M.,
G. Adjorlolo,
E. Ekpini,
T. Sibailly,
J. Kouadio,
M. Maran,
K. Brattegaard,
K. M. Vetter,
R. Doorly, and H. D. Gayle.
1993.
Epidemiology and transmission of HIV-2: why there is no HIV-2 pandemic.
JAMA
270:2083-2086[Abstract/Free Full Text].
|
| 19.
|
Deng, H.,
R. Liu,
W. Ellmeier,
S. Choe,
D. Unutmaz,
M. Burkhart,
P. Di Marzio,
S. Marmon,
R. E. Sutton,
C. M. Hill,
C. B. Davis,
S. C. Peiper,
T. J. Schall,
D. R. Littman, and N. R. Landau.
1996.
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661-666[CrossRef][Medline].
|
| 20.
|
Deng, H. K.,
D. Unutmaz,
V. N. Kewalramani, and D. R. Littman.
1997.
Expression cloning of new receptors used by simian and human immunodeficiency viruses.
Nature
388:296-300[CrossRef][Medline].
|
| 21.
|
Desrosiers, R. C., and D. J. Ringler.
1989.
Use of SIV for AIDS research.
Intervirology
30:301-312[Medline].
|
| 22.
|
Doms, R. W., and S. C. Peiper.
1997.
Unwelcome guests with master keys: how HIV uses chemokine receptors for cellular entry.
Virology
235:179-190[CrossRef][Medline].
|
| 23.
|
Doranz, B. J.,
J. Rucker,
Y. Yi,
R. J. Smyth,
M. Samson,
S. C. Peiper,
M. Parmentier,
R. G. Collman, and R. W. Doms.
1996.
A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.
Cell
85:1149-1158[CrossRef][Medline].
|
| 24.
|
Dragic, T.,
V. Litwin,
G. P. Allaway,
S. R. Martin,
Y. Huang,
K. A. Nagashima,
C. Cayanan,
P. J. Maddon,
R. A. Koup,
J. P. Moore, and W. A. Paxton.
1996.
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5.
Nature
381:667-673[CrossRef][Medline].
|
| 25.
|
Dragic, T.,
A. Trkola,
S. W. Lin,
P. A. Nagashima,
F. Kajumo,
L. Zhao,
W. C. Olson,
L. Wu,
C. R. Mackay,
G. P. Allaway,
T. P. Sakmar,
J. P. Moore, and P. J. Maddon.
1998.
Amino-terminal substitutions in the CCR5 coreceptor impair gp120 binding and human immunodeficiency virus type 1 entry.
J. Virol.
72:279-285[Abstract/Free Full Text].
|
| 26.
|
Edinger, A. L.,
A. Amedee,
K. Miller,
B. J. Doranz,
M. Endres,
M. Sharron,
M. Samson,
Z. H. Lu,
J. E. Clements,
M. Murphey-Corb,
S. C. Peiper,
M. Parmentier,
C. C. Broder, and R. W. Doms.
1997.
Differential utilization of CCR5 by macrophage and T cell tropic simian immunodeficiency virus strains.
Proc. Natl. Acad. Sci. USA
94:4005-4010[Abstract/Free Full Text].
|
| 27.
|
Edinger, A. L.,
J. L. Mankowski,
B. J. Doranz,
B. J. Margulies,
B. Lee,
J. Rucker,
M. Sharron,
T. L. Hoffman,
J. F. Berson,
M. C. Zink,
V. M. Hirsch,
J. E. Clements, and R. W. Doms.
1997.
CD4-independent, CCR5-dependent infection of brain capillary endothelial cells by a neurovirulent simian immunodeficiency virus strain.
Proc. Natl. Acad. Sci. USA
94:14742-14747[Abstract/Free Full Text].
|
| 28.
|
Edinger, A. L.,
T. L. Hoffman,
M. Sharron,
B. Lee,
B. O'Dowd, and R. W. Doms.
1998.
Use of GPR1, GPR15, and STRL33 as coreceptors by diverse human immunodeficiency virus type 1 and simian immunodeficiency virus envelope proteins.
Virology
249:367-378[CrossRef][Medline].
|
| 29.
|
Edinger, A. L.,
T. L. Hoffman,
Y. Yi,
M. Sharron,
R. G. Collman,
B. Mitrovic,
D. Faulds,
J. Hesselgesser,
R. Horuk, and R. W. Doms.
1998.
An orphan seven transmembrane domain receptor expressed widely in the brain functions as a coreceptor for HIV-1 and SIV.
J. Virol.
72:7934-7940[Abstract/Free Full Text].
|
| 30.
|
Edinger, A. L.,
C. Blanpain,
K. J. Kunstman,
S. M. Wolinsky,
M. Parmentier, and R. W. Doms.
1999.
Functional dissection of CCR5 coreceptor function through the use of CD4-independent simian immunodeficiency virus strains.
J. Virol.
73:4062-4073[Abstract/Free Full Text].
|
| 31.
|
Farzan, M.,
H. Choe,
K. Martin,
L. Marcon,
W. Hofmann,
G. Karlsson,
Y. Sun,
P. Barrett,
N. Marchand,
N. Sullivan,
N. Gerard,
C. Gerard, and J. Sodroski.
1997.
Two orphan seven-transmembrane segment receptors which are expressed in CD4-positive cells support simian immunodeficiency virus infection.
J. Exp. Med.
186:405-411[Abstract/Free Full Text].
|
| 32.
|
Farzan, M.,
H. Choe,
L. Vaca,
K. Martin,
Y. Sun,
E. Desjardins,
N. Ruffing,
L. Wu,
R. Wyatt,
N. Gerard,
C. Gerard, and J. Sodroski.
1998.
A tyrosine-rich region in the N terminus of CCR5 is important for human immunodeficiency virus type 1 entry and mediates an association between gp120 and CCR5.
J. Virol.
72:1160-1164[Abstract/Free Full Text].
|
| 33.
|
Farzan, M.,
T. Mirzabekov,
P. Kolchinsky,
R. Wyatt,
M. Cayabyab,
N. P. Gerard,
C. Gerard,
J. Sodroski, and H. Choe.
1999.
Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1 entry.
Cell
96:667-676[CrossRef][Medline].
|
| 34.
|
Feng, Y.,
C. C. Broder,
P. E. Kennedy, and E. A. Berger.
1996.
HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor.
Science
272:872-877[Abstract].
|
| 35.
|
Gao, F.,
L. Yue, and A. T. White.
1992.
Human infection by genetically diverse SIVSM-related HIV-2 in west Africa.
Nature
358:495-499[CrossRef][Medline].
|
| 36.
|
Gardner, M. B.
1996.
The history of simian AIDS.
J. Med. Primatol.
25:148-157[Medline].
|
| 37.
|
Hill, C. M.,
H. Deng,
D. Unutmaz,
V. N. Kewalramani,
L. Bastiani,
M. K. Gorny,
S. Zolla-Pazner, and D. R. Littman.
1997.
Envelope glycoproteins from human immunodeficiency virus types 1 and 2 and simian immunodeficiency virus can use human CCR5 as a coreceptor for viral entry and make direct CD4-dependent interactions with this chemokine receptor.
J. Virol.
71:6296-6304[Abstract].
|
| 38.
|
Horuk, R.,
J. Hesselgesser,
Y. Zhou,
D. Faulds,
D. Taub,
M. Samson,
M. Parmentier,
J. Rucker,
B. J. Doranz, and R. W. Doms.
1998.
The CC chemokine I309 is a functional ligand for ChemR1/CCR8 and inhibits ChemR1/CCR8 dependent infection by diverse HIV-1 strains.
J. Biol. Chem.
273:386-391[Abstract/Free Full Text].
|
| 39.
|
Johnson, P. R., and V. M. Hirsch.
1992.
SIV infection of macaques as a model for AIDS pathogenesis.
Int. Rev. Immunol.
8:55-63[Medline].
|
| 40.
|
Kestler, H. W.,
T. Kodama,
D. Ringler,
M. Marthas,
N. Pedersen,
A. Lackner,
D. Regier,
P. Sehgal,
M. D. Daniel, and R. C. Desrosiers.
1990.
Induction of AIDS in rhesus monkeys by molecularly cloned simian immunodeficiency virus.
Science
248:1109-1112[Abstract/Free Full Text].
|
| 41.
|
Kirchhoff, F.,
S. Pöhlmann,
M. Hamacher,
R. E. Means,
T. Kraus,
K. Überla, and P. Di Marzio.
1997.
Simian immunodeficiency virus variants with differential T-cell and macrophage tropism use CCR5, and an unidentified cofactor expressed in CEMx174 cells for efficient entry.
J. Virol.
71:6509-6516[Abstract].
|
| 42.
|
Kozak, S. L.,
E. J. Platt,
N. Madani,
F. E. Ferro,
K. Peden, and D. Kabat.
1997.
CD4, CXCR-4, and CCR5 dependencies for infections by primary patient and laboratory-adapted isolates of human immunodeficiency virus type 1.
J. Virol.
71:873-882[Abstract].
|
| 43.
|
Lee, B.,
M. Sharron,
C. Blanpain,
B. J. Doranz,
J. Vakili,
P. Setoh,
E. Berg,
G. Liu,
H. R. Guy,
S. R. Durell,
M. Parmentier,
C. N. Chang,
K. Price,
M. Tsang, and R. W. Doms.
1999.
Epitope mapping of CCR5 reveals multiple conformational states and distinct but overlapping structures involved in chemokine and coreceptor function.
J. Biol. Chem.
274:9617-9626[Abstract/Free Full Text].
|
| 44.
|
Lee, B.,
M. Sharron,
L. J. Montaner,
D. Weissman, and R. W. Doms.
1999.
Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages.
Proc. Natl. Acad. Sci. USA
96:5215-5220[Abstract/Free Full Text].
|
| 45.
|
Letvin, N. L.,
M. D. Daniel,
P. K. Sehgal,
R. C. Desrosiers,
R. D. Hunt,
L. M. Waldron,
J. J. MacKey,
D. K. Schmidt,
L. V. Chalifoux, and N. W. King.
1985.
Induction of AIDS-like disease in macaque monkeys with T-cell tropic retrovirus STLV-III.
Science
230:71-73[Abstract/Free Full Text].
|
| 46.
|
Liao, F.,
G. Alkhatib,
K. W. Peden,
G. Sharma,
E. A. Berger, and J. M. Farber.
1997.
STRL33, A novel chemokine receptor-like protein, functions as a fusion cofactor for both macrophage-tropic and T cell line-tropic HIV-1.
J. Exp. Med.
185:2015-2023[Abstract/Free Full Text].
|
| 47.
|
Loetscher, M.,
A. Amara,
E. Oberlin,
N. Brass,
D. Legler,
P. Loetscher,
M. D'Apuzzo,
E. Meese,
D. Rousset,
J. L. Virelizier,
M. Baggiolini,
F. Arenzana-Seisdedos, and B. Moser.
1997.
TYMSTR, a putative chemokine receptor selectively expressed in activated T cells, exhibits HIV-1 coreceptor function.
Curr. Biol.
7:652-660[CrossRef][Medline].
|
| 48.
|
Marcon, L.,
H. Choe,
K. Martin,
M. Farzan,
P. D. Ponath,
L. Wu,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1997.
Utilization of C-C chemokine receptor 5 by the envelope glycoproteins of a pathogenic simian immunodeficiency virus, SIVmac239.
J. Virol.
71:2522-2537[Abstract].
|
| 49.
|
Marlink, R. G.,
D. Ricard,
S. M. Boup,
P. J. Kanki,
J. L. Romet-Lemonne,
I. N. Doye,
K. Diop,
M. A. Simpson,
F. Greco,
M. J. Chou,
V. Degruttola,
C. C. Hsieh,
C. Boye,
F. Barin,
F. Denis,
M. F. McLane, and M. Essex.
1988.
Clinical, hematological, and immunologic cross-sectional evaluation of individuals exposed to human immunodeficiency virus type-2 (HIV-2).
AIDS Res. Hum. Retroviruses
4:137-148[Medline].
|
| 50.
|
Marx, P. A., and Z. Chen.
1998.
The function of simian chemokine receptors in the replication of SIV.
Semin. Immunol.
10:215-223[CrossRef][Medline].
|
| 51.
|
Moore, J. P.,
A. Trkola, and T. Dragic.
1997.
Co-receptors for HIV-1 entry.
Curr. Opin. Immunol.
9:551-562[CrossRef][Medline].
|
| 52.
|
Mori, K.,
D. J. Ringler,
T. Kodama, and R. C. Desrosiers.
1992.
Complex determinants of macrophage tropism in env of simian immunodeficiency virus.
J. Virol.
66:2067-2075[Abstract/Free Full Text].
|
| 53.
|
Mori, K.,
D. J. Ringler, and R. C. Desrosiers.
1993.
Restricted replication of simian immunodeficiency virus strain 239 in macrophages is determined by env but is not due to restricted entry.
J. Virol.
67:2807-2814[Abstract/Free Full Text].
|
| 54.
|
Mörner, A.,
A. Björndal,
J. Albert,
V. N. Kewalramani,
D. R. Littman,
R. Inoue,
R. Thorstensson,
E. M. Fenyo, and E. Bjorling.
1999.
Primary human immunodeficiency virus type 2 (HIV-2) isolates, like HIV-1 isolates, frequently use CCR5 but show promiscuity in coreceptor usage.
J. Virol.
73:2343-2349[Abstract/Free Full Text].
|
| 55.
|
Murphey-Corb, M.,
L. N. Martin,
S. R. Rangan,
G. B. Baskin,
B. J. Gormus,
R. H. Wolf,
W. A. Andes,
M. West, and R. C. Montelaro.
1986.
Isolation of an HTLV-III related retrovirus from macaques with simian AIDS and its possible origin in asymptomatic mangabeys.
Nature
321:435-437[CrossRef][Medline].
|
| 56.
|
Naidu, Y. M.,
H. W. Kestler,
Y. Li,
C. V. Butler,
D. P. Silva,
D. K. Schmidt,
C. D. Troup,
P. K. Sehgal,
P. Sonigo,
M. D. Daniel, and R. C. Desrosiers.
1988.
Characterization of infectious molecular clones of simian immunodeficiency virus (SIVmac) and human immunodeficiency virus type 2: persistent infection of rhesus monkeys with molecularly cloned SIVmac.
J. Virol.
62:4691-4696[Abstract/Free Full Text].
|
| 57.
|
Owen, S. M.,
D. Ellenberger,
M. Rayfield,
S. Wiktor,
P. Michel,
M. H. Grieco,
F. Gao,
B. H. Hahn, and R. B. Lal.
1998.
Genetically divergent strains of human immunodeficiency virus type 2 use multiple coreceptors for viral entry.
J. Virol.
72:5425-5432[Abstract/Free Full Text].
|
| 58.
|
Platt, E. J.,
K. Wehrly,
S. E. Kuhnman,
B. Chesbro, and D. Kabat.
1998.
Effects of CCR5 and CD4 cell surface concentrations on infections by macrophage-tropic isolates of human immunodeficiency virus type 1.
J. Virol.
72:2855-2864[Abstract/Free Full Text].
|
| 59.
|
Pöhlmann, S.,
M. Krumbiegel, and F. Kirchhoff.
1999.
Coreceptor usage of BOB/GPR-15 and Bonzo/STRL-33 by primary HIV-1 isolates.
J. Gen. Virol.
80:1241-1251[Abstract].
|
| 60.
|
Pöhlmann, S.,
N. Stolte,
J. Münch,
P. Ten Haaft,
J. L. Heeney,
C. Stahl-Hennig, and F. Kirchhoff.
1999.
Co-receptor usage of BOB/GPR15 in addition to CCR5 has no significant effect on replication of simian immunodeficiency virus in vivo.
J. Infect. Dis.
180:1494-1502[CrossRef][Medline].
|
| 61.
|
Rabut, G. E.,
J. A. Konner,
F. Kajumo,
J. P. Moore, and T. Dragic.
1998.
Alanine substitutions of polar and nonpolar residues in the amino-terminal domain of CCR5 differently impair entry of macrophage- and dualtropic isolates of human immunodeficiency virus type 1.
J. Virol.
72:3464-3468[Abstract/Free Full Text].
|
| 62.
|
Regier, D. A., and R. C. Desrosiers.
1990.
The complete nucleotide sequence of a pathogenic molecular clone of SIV.
AIDS Res. Hum. Retroviruses
6:1221-1231[Medline].
|
| 63.
|
Reiprich, S.,
B. R. Gundlach,
B. Fleckenstein, and K. Überla.
1997.
Replication-competent chimeric lenti-oncovirus with expanded host cell tropism.
J. Virol.
71:3328-3331[Abstract].
|
| 64.
|
Ross, T. M.,
P. D. Bieniasz, and B. R. Cullen.
1998.
Multiple residues contribute to the inability of murine CCR-5 to function as a coreceptor for macrophage-tropic human immunodeficiency virus type 1 isolates.
J. Virol.
72:1918-1924[Abstract/Free Full Text].
|
| 65.
|
Rucker, J.,
A. L. Edinger,
M. Sharron,
M. Samson,
B. Lee,
J. F. Berson,
Y. Yi,
B. Margulies,
R. G. Collman,
B. J. Doranz,
M. Parmentier, and R. W. Doms.
1997.
Utilization of chemokine receptors, orphan receptors, and herpesvirus-encoded receptors by diverse human and simian immunodeficiency viruses.
J. Virol.
71:8999-9007[Abstract].
|
| 66.
|
Samson, M.,
A. L. Edinger,
P. Stordeur,
J. Rucker,
V. Verhasselt,
M. Sharron,
C. Govaerts,
C. Mollereau,
G. Vassart,
R. W. Doms, and M. Parmentier.
1998.
ChemR23, a putative chemoattractant receptor, is expressed in dendritic cells and is a coreceptor for SIV and some primary HIV-1 strains.
Eur. J. Immunol.
26:3021-3028.
|
| 66a.
| Sharron, M., S. Pöhlmann, M. Tsang, F. Kirchhoff,
R. W. Doms, and B. Lee. Characterization of STRL33 expression and
coreceptor activity. Blood, in press.
|
| 67.
|
Singh, A.,
G. Besson,
A. Mobasher, and R. G. Collman.
1999.
Patterns of chemokine receptor fusion cofactor utilization by human immunodeficiency virus type 1 variants from the lungs and blood.
J. Virol.
73:6680-6690[Abstract/Free Full Text].
|
| 68.
|
Unutmaz, D.,
V. N. Kewalramani, and D. R. Littman.
1998.
G protein-coupled receptors in HIV and SIV entry: new perspectives on lentivirus-host interactions and on the utility of animal models.
Semin. Immunol.
10:225-236[CrossRef][Medline].
|
| 69.
|
Zhang, L.,
T. He,
Y. Huang,
Z. Chen,
Y. Guo,
S. Wu,
K. J. Kunstman,
R. C. Brown,
J. P. Phair,
A. U. Neumann,
D. D. Ho, and S. M. Wolinsky.
1998.
Chemokine coreceptor usage by diverse primary isolates of human immunodeficiency virus type 1.
J. Virol.
72:9307-9312[Abstract/Free Full Text].
|
| 70.
|
Zhang, Y. J.,
T. Dragic,
Y. Cao,
L. Kostrikis,
D. S. Kwon,
D. R. Littman,
V. N. Kewalramani, and J. P. Moore.
1998.
Use of coreceptors other than CCR5 by non-syncytium-inducing adult and pediatric isolates of human immunodeficiency virus type 1 is rare in vitro.
J. Virol.
72:9337-9344[Abstract/Free Full Text].
|
| 71.
|
Zhang, Y. J., and J. P. Moore.
1999.
Will multiple coreceptors need to be targeted by inhibitors of human immunodeficiency virus type 1 entry?
J. Virol.
73:3443-3448[Abstract/Free Full Text].
|
| 72.
|
Zhang, Y. W.,
O. A. Ryder, and Y. P. Zhang.
1999.
Sequence evolution of the CCR5 chemokine receptor gene in primates.
Mol. Biol. Evol.
16:1145-1154[Abstract].
|
Journal of Virology, June 2000, p. 5075-5082, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hrecka, K., Swigut, T., Schindler, M., Kirchhoff, F., Skowronski, J.
(2005). Nef Proteins from Diverse Groups of Primate Lentiviruses Downmodulate CXCR4 To Inhibit Migration to the Chemokine Stromal Derived Factor 1. J. Virol.
79: 10650-10659
[Abstract]
[Full Text]
-
Pohlmann, S., Davis, C., Meister, S., Leslie, G. J., Otto, C., Reeves, J. D., Puffer, B. A., Papkalla, A., Krumbiegel, M., Marzi, A., Lorenz, S., Munch, J., Doms, R. W., Kirchhoff, F.
(2004). Amino Acid 324 in the Simian Immunodeficiency Virus SIVmac V3 Loop Can Confer CD4 Independence and Modulate the Interaction with CCR5 and Alternative Coreceptors. J. Virol.
78: 3223-3232
[Abstract]
[Full Text]
-
Ploquin, M. J.-Y., Diop, O. M., Sol-Foulon, N., Mortara, L., Faye, A., Soares, M. A., Nerrienet, E., Le Grand, R., Van Kooyk, Y., Amara, A., Schwartz, O., Barre-Sinoussi, F., Muller-Trutwin, M. C.
(2004). DC-SIGN from African Green Monkeys Is Expressed in Lymph Nodes and Mediates Infection in trans of Simian Immunodeficiency Virus SIVagm. J. Virol.
78: 798-810
[Abstract]
[Full Text]
-
Veazey, R. S., Klasse, P. J., Ketas, T. J., Reeves, J. D., Piatak, M. Jr., Kunstman, K., Kuhmann, S. E., Marx, P. A., Lifson, J. D., Dufour, J., Mefford, M., Pandrea, I., Wolinsky, S. M., Doms, R. W., DeMartino, J. A., Siciliano, S. J., Lyons, K., Springer, M. S., Moore, J. P.
(2003). Use of a Small Molecule CCR5 Inhibitor in Macaques to Treat Simian Immunodeficiency Virus Infection or Prevent Simian-Human Immunodeficiency Virus Infection. JEM
198: 1551-1562
[Abstract]
[Full Text]
-
Puffer, B. A., Pohlmann, S., Edinger, A. L., Carlin, D., Sanchez, M. D., Reitter, J., Watry, D. D., Fox, H. S., Desrosiers, R. C., Doms, R. W.
(2002). CD4 Independence of Simian Immunodeficiency Virus Envs Is Associated with Macrophage Tropism, Neutralization Sensitivity, and Attenuated Pathogenicity. J. Virol.
76: 2595-2605
[Abstract]
[Full Text]
-
Baribaud, F., Pohlmann, S., Sparwasser, T., Kimata, M. T. Y., Choi, Y.-K., Haggarty, B. S., Ahmad, N., Macfarlan, T., Edwards, T. G., Leslie, G. J., Arnason, J., Reinhart, T. A., Kimata, J. T., Littman, D. R., Hoxie, J. A., Doms, R. W.
(2001). Functional and Antigenic Characterization of Human, Rhesus Macaque, Pigtailed Macaque, and Murine DC-SIGN. J. Virol.
75: 10281-10289
[Abstract]
[Full Text]
-
Pöhlmann, S., Baribaud, F., Lee, B., Leslie, G. J., Sanchez, M. D., Hiebenthal-Millow, K., Münch, J., Kirchhoff, F., Doms, R. W.
(2001). DC-SIGN Interactions with Human Immunodeficiency Virus Type 1 and 2 and Simian Immunodeficiency Virus. J. Virol.
75: 4664-4672
[Abstract]
[Full Text]
-
Mori, K., Rosenzweig, M., Desrosiers, R. C.
(2000). Mechanisms for Adaptation of Simian Immunodeficiency Virus to Replication in Alveolar Macrophages. J. Virol.
74: 10852-10859
[Abstract]
[Full Text]
-
Sharron, M., Pohlmann, S., Price, K., Lolis, E., Tsang, M., Kirchhoff, F., Doms, R. W., Lee, B.
(2000). Expression and coreceptor activity of STRL33/Bonzo on primary peripheral blood lymphocytes. Blood
96: 41-49
[Abstract]
[Full Text]
Top
Abstract
Introduction
