Previous Article | Next Article 
Journal of Virology, September 1998, p. 7115-7124, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Polyserine Tract of Herpes Simplex Virus ICP4 Is Required
for Normal Viral Gene Expression and Growth in Murine
Trigeminal Ganglia
Patricia A.
Bates and
Neal A.
DeLuca*
Department of Molecular Genetics and
Biochemistry, University of Pittsburgh School of Medicine,
Pittsburgh, Pennsylvania 15261
Received 17 March 1998/Accepted 4 June 1998
 |
ABSTRACT |
ICP4 of herpes simplex virus (HSV) is essential for productive
infection due to its central role in the regulation of HSV transcription. This study identified a region of ICP4 that is not
required for viral growth in culture or at the periphery of experimentally inoculated mice but is critical for productive growth in
the trigeminal ganglia. This region of ICP4 encompasses amino
acids 184 to 198 and contains 13 nearly contiguous serine residues that
are highly conserved among the alphaherpesviruses. A mutant in which
this region is deleted (
SER) was able to grow on the corneas of mice
and be transported back to the trigeminal ganglia.
SER did not grow
in the trigeminal ganglia but did express low levels of several
immediate-early (ICP4 and ICP27) and early (thymidine kinase
[tk] and UL42) genes. It expressed very low levels of the
late gC gene and did not appear to replicate DNA. This pattern of gene
expression was similar to that observed for a tk mutant,
dlsptk. Both
SER and dlsptk expressed higher
levels of the latency-associated transcript (LAT) per genome earlier in
infected ganglia than did the wild-type virus, KOS. However, infected
ganglia from all three viruses accumulated the same level of LAT
per genome at 30 days postinfection (during latency). The data suggest
that the polyserine tract of ICP4 provides an activity that is required
for lytic infection in ganglia to progress to viral DNA synthesis and
full lytic gene expression. In the absence of this activity, higher
levels of LAT per genome accumulate earlier in infection than with
wild-type virus.
 |
INTRODUCTION |
Herpes simplex virus type 1 (HSV-1),
a member of the Alphaherpesvirinae, is
recognized by its rapid lytic growth characteristics, variable host
range, and propensity to establish and reactivate from latent infection
in neurons of sensory ganglia. Lytic HSV infection progresses with the
regulated expression of viral genes in three temporal phases,
immediate-early (IE;
), early (E;
), and late (L;
)
(37), coordinating the events required for assembly of
infectious progeny virus with the inevitable destruction of the
infected cell. In neurons, the virus can either initiate a productive
infection or establish a latent infection in which transcription from
the viral genome is relatively silent (44, 45, 72), with the
exception of the latency-associated transcript (LAT) (13, 14, 60,
64, 72). In vivo, the latent genomes persist in the sensory
ganglia (11, 23, 64), where certain stresses can trigger
reactivation of the lytic cycle, resulting in recurrent infection at
mucocutaneous sites and shedding of progeny virus (for reviews, see
references 28 and 73). The transition between lytic and latent infection presumably requires an
elaborate array of viral functions which is reflected in the number and
complexity of accessory proteins encoded by the HSV genome. While there
are probably several critical checkpoints that determine the fate of
HSV infection in the neuron, one of the most obvious targets for
regulating lytic growth is the viral protein ICP4.
ICP4 is a large (175-kDa) DNA-binding (21, 26)
phosphoprotein (12, 61) that exists as a homodimer (55,
68) and is localized primarily in the nucleus of the infected
cell (12, 61). During viral infection, ICP4 is required for
the transcriptional activation of most of the essential E and L genes
(19, 24, 30, 31, 57). ICP4 also acts as a repressor of its
own expression (19, 58, 59) as well as that of LAT (3,
4, 62) and L/ST (long/short transcripts) (5, 78). ICP4
contains discrete functional domains which determine DNA binding,
dimerization, nuclear localization, and transcriptional activation
(18, 59, 60, 68). The DNA-binding activity is important for
transcriptional activation by ICP4 (60, 68) and essential to
its function as a repressor of activated transcription (35, 36,
63). Two additional regions within ICP4 contribute to
transcriptional activation, a large domain defined by the
carboxy-terminal region of the protein (amino acids [aa] 775 to 1298)
(17, 18, 68) and a small serine-rich region near the amino
terminus (aa 143 to 210) (68). The carboxy-terminal domain
is required for high-level activation by ICP4 and, hence viral growth,
because it supports the interaction of ICP4 with TFIID (6).
ICP4 proteins lacking the carboxy-terminal region activate
transcription poorly (6, 17, 18, 34). Further removal of the
amino acids between residues 143 and 210 completely abrogates the
activation function (65, 68, 69).
Deletion of only the serine-rich region (aa 143 to 210) results in a
virus that is marginally impaired for growth in culture and in the eyes
of infected mice but is completely impaired for viral growth in the
trigeminal ganglia (77). Besides an unusual polyserine tract
(aa 184 to 198), this region contains consensus sites for the cellular
kinases protein kinase A (PKA), PKC, and casein kinase II (CKII), as
well as a target of in vitro autophosphorylation (76, 77).
Given the abundance of potential kinase targets, it follows that
removal of this domain results in a significantly hypophosphorylated
ICP4 (20, 76). Despite the apparent interaction of this
region with several kinases, mutants lacking this region are
qualitatively functional by all in vitro assessments (6, 34, 65,
69). The entire region between aa 143 and 210 demonstrates relatively little conservation among the alphaherpesvirus ICP4 homologs. However, similar stretches of polyserine residues
corresponding to residues 184 to 198 of HSV-1 ICP4 are found in region
1 of the ICP4 homologs of HSV-2 (24), varicella-zoster
virus, simian varicella herpesvirus, pseudorabies virus, Marek's
disease virus, equine herpesvirus 1, and region 5 of bovine herpesvirus
1 (1, 8, 25, 32, 33, 54, 66). A similar polyserine tract also appears in a small cellular protein, P15 (29, 47),
which supports the activation function of VP16 and possibly other
activators (29, 40). While the functional significance of
the polyserine motif is not known, the conservation of these residues
among these neurotropic viruses may indicate that it imparts to ICP4
and its homologs an activity required for gene regulation or function in neurons, despite its dispensability in cell culture.
In the classically defined temporal cascade of HSV gene expression,
activation of only one temporal phase,
2 or L, is
dependent on viral replication (39, 42, 52). In neurons,
viral DNA synthesis is similarly required for induction of the
2 genes, but in contrast to lytic infection, it has also
been reported to enhance expression of the
and
genes (43,
56). During acute infection, reduced expression of
and
genes has been observed in mouse ganglia infected with a thymidine
kinase (tk) mutant (43) or a mutant that blocks
replication in neurons, as well as in HSV-infected primary rat cervical
ganglia neuron cultures treated with inhibitors of viral DNA
replication (56). It has been hypothesized that in neurons,
viral replication may enhance transcription of the IE genes directly by
altering the template (43, 56). The enhanced expression of
ICP4 following replication may also be reflective of alleviation from
repression by LAT (3, 4, 62) a transcript of unknown
function which has been reported to down-regulate productive cycle
genes (7, 27). By this scenario, viral DNA replication is
the rate-limiting step, pivotal in determining whether lytic infection
proceeds or is suspended to the latent state. Assuming that gene
expression may differ between neuronal and nonneuronal cells, it
follows that some of the viral activities regulating gene expression
may also differ.
In this study, we examined the contribution of the conserved polyserine
tract in the HSV-1 regulatory protein ICP4 to viral growth in tissue
culture and in neuronal and nonneuronal cells in vivo. The fate of the
viral genomes containing mutations in the polyserine tract in murine
trigeminal ganglia was also determined as infection proceeded from the
acute to the latent phase. Last, gene expression from a polyserine
tract mutant in acutely and latently infected ganglia was compared to
that from wild-type (wt) virus and a tk mutant virus to
assess the point where infection of ganglia is blocked. The results
suggest that the polyserine tract supports an activity of ICP4
specifically required for growth in the sensory ganglia. In the absence
of this function, lytic infection of ganglia is blocked at a point
similar to that for tk mutants.
 |
MATERIALS AND METHODS |
Virus and cells.
Vero cells were used for the isolation of
viral mutants, yield assays, and labeling of viral proteins. E5 cells
(17, 62), which express complementing levels of the
wild-type ICP4 upon infection, were used to assay and propagate viral
stocks. The wt virus used in these studies was KOS (16). The
mutants n12 (17), d8-10 (68), and
dlsptk (10) were previously described. dlsptk was kindly provided by Donald Coen, Harvard Medical
School, Boston, Mass. The procedures for propagating and assaying viral stocks were as previously described (22).
Virus construction.
The construction of plasmid p[i8-i10],
containing only the ICP4 coding sequences corresponding to aa 143 to
210 (Fig. 1A), consisted
of cloning the 78-bp PstI-AatII fragment from
plasmid pi8 (68) and the 135-bp
AatII-PstI fragment from plasmid pi10 (68) into the PstI site of pUC18. The previously
described plasmids pi8 and pi10 contain in-frame PstI
oligonucleotide insertions encoding three alanines after aa 142 and
210, respectively (68). The
SER mutation was constructed
in p[i8-i10] by using a Transformer site-directed mutagenesis kit
(Clontech) and the accompanying protocol. The mutagenic primer,
5'-GTCGTCGTCCTCGTCCTCGTCCAACGCGTTCCCGGAGTCCGACGAGGTCGA-3', had a deletion of amino acids 184 to 198 and insertion of a
unique MluI site and three amino acids,
asparagine-alanine-leucine (Fig. 1A). This manipulation was confirmed
by DNA sequencing. To generate the full-length ICP4 coding sequences
with the
SER mutation, the 168-bp PstI fragment of
p[i8-i10] containing the
SER mutation was cloned into
PstI-digested pdi8-i10 (68), replacing the
wild-type sequences between residues 143 and 210 with the analogous
region containing the
SER mutation.

View larger version (18K):
[in this window]
[in a new window]

View larger version (27K):
[in this window]
[in a new window]

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
ICP4 serine tract mutations. (A) The genomic location
and direction of transcription (arrowheads) of ICP4 are shown along
with the BamHI restriction sites in reference to the ICP4
coding region. The BamHI Y fragment and the serine tract
region (aa 143 to 210) deleted in mutant d8-10 (68,
77) are indicated. The corresponding wt (KOS) and mutant
(CKII and SER) sequences are compared, showing the
deleted (dots) and substituted (italics) residues in reference to the
consensus sites for the cellular kinases PKA and CKII. Amino acids that
are conserved in the HSV-1 and pseudorabies virus (8) or
varicella-zoster virus (54) ICP4 homologs are designated in
boldface; underlined residues are conserved in all three. (B) Fine map
of the BamHI Y fragment in the wt (KOS) and mutant viruses
is shown with the relevant restriction sites for determining the
presence of the CKII and SER mutations. Southern blots
of viral DNA digested with the indicated restriction enzymes and
hybridized to labeled BamHI-Y probe are shown on the right
along with the sizes of the expected fragments. (C) Fine map of the
BamHI Y fragment is shown with the relevant restriction
sites for determining the structures of the r SER and vi8-i10
viruses. Southern blots of viral DNA digested with the indicated
restriction enzymes and hybridized to labeled BamHI-Y probe
are shown on the right along with the sizes of the expected
fragments.
|
|
The CKII

mutant was made by combining the
HindIII-
EarI fragment and the
HindIII-
PstI fragment from pi10
(
68) with the oligonucleotides
5'-TCCGGAGCCGCAGCTGCA-3'
and 5'-GCTGCGGCTCC-3', which replace
the acidic amino
acids of the CKII consensus site with the amino
acid sequence SAAAAA
and insert a new
BspE1 restriction site (Fig.
1A).
The

SER and the CKII

mutations were introduced into
the virus by cotransfecting 10
6 E5 cells with 3 µg of the
4.2-kb
EcoRI fragment of either the

SER or the
CKII

plasmid and 3 µg of n12 viral DNA, using the
calcium phosphate
coprecipitation method (
17). n12 is a
previously described ICP4-deficient
virus containing an oligonucleotide
specifying a nonsense mutation
and an
HpaI restriction site
at aa 250 (
17). Viruses carrying
these mutations were
selected for rescued growth on Vero cells,
and the presence of the
mutations in both copies of ICP4 was confirmed
by several rounds of
Southern blot analysis and plaque purification.
As a control, a virus containing the same i8 and i10 insertion
mutations as were present in

SER was also constructed. Individually,
the i8 and i10 insertions have been shown not to affect the activity
of
ICP4 (
68). The full-length i8-i10 mutant ICP4 was
constructed
by inserting the 204-bp
PstI fragment of
p[i8-i10] into the
PstI
site of plasmid pdi8-i10
(
68) to generate pi8-i10. Using the
protocol described above
for construction of the

SER virus, the
4.2-kb
EcoRI
fragment of pi8-i10 was cotransfected with n12 DNA
on E5 cells, and
subsequently the desired construct was selected
for growth on Vero
cells. The presence of the i8-i10 insertions
in both copies of ICP4 was
confirmed by Southern blot analysis.
To rescue the

SER viral mutation, 10
6 E5 cells were
cotransfected with 3 µg of the 1.84-kb
BamHI Y fragment
from wild-type
ICP4 plasmid pK1-2 (
17) and 3 µg of

SER
viral DNA, using calcium
phosphate coprecipitation (
17).
Plaque isolates from the progeny
of the transfection were amplified,
and rescued viruses were identified
by the presence of the full-length
1.84-kb
BamHI Y fragment determined
by Southern blot
analysis. Such isolates were further plaque purified
and rechecked by
Southern blot analysis.
Virus yield assays.
The assay to determine virus yield was
done as previously described (77). Burst size for each virus
was expressed as the total PFU yield per infected cell.
Analysis of viral proteins.
Viral polypeptides were
radiolabeled by incubating 6 × 105 cells infected at
a multiplicity of infection (MOI) of 10 PFU/cell with 100 µCi of
[35S]methionine per ml of methionine-deficient medium for
1 h at the indicated times postinfection. The polypeptides were
extracted from cells, using sodium dodecyl sulfate (SDS) sample buffer
as previously described (77), and analyzed by
SDS-polyacrylamide gel electrophoresis (PAGE) (48).
Animal studies.
Five- to six-week-old male and female CD-1
mice (Charles River Laboratories) were inoculated with 2 × 106 PFU/eye via corneal scarification (51). The
assays monitoring acute growth at the site of inoculation and in the
trigeminal ganglia, and that for in vitro reactivation, were done as
previously described (51). For the PCR and reverse
transcriptase (RT)-mediated PCR (RT-PCR) analysis of viral genome copy
number and gene expression in the trigeminal ganglia, ganglia were
removed at the indicated times postinfection and frozen in liquid
nitrogen as previously described (44-46).
PCR analysis of viral DNA.
PCR analysis was used to quantify
the average number of viral genomes present in ganglia DNA from
infected mice as previously described (41), with minor
modifications. The primers specific for the viral gene gC
(5'-GGGTCCGTCCCCCCCAAT-3' and 5'-CGTTAGGTTGGGGGCGCT-3') and cellular
-actin (5'-AACCCTAAGGCCAACCGTGAAAAGATGACC-3'
and 5'-CCAGGGAGGAAGAGGATGCGGC-3') (46, 49)
were used to amplify the target sequences without additives included in
the PCR amplification of
-actin. The PCR products were separated on
native 8% polyacrylamide gels containing 0.5× Tris-borate-EDTA (TBE),
transferred to GeneScreen Plus (NEN), and then probed with
oligonucleotides specific for the PCR products that were
32P end labeled as previously described (45).
The probed filters were exposed to X-ray film to obtain an
autoradiographic image and also quantified with an Ambis Radioanalytic
Imager. The number of viral genomes per cell equivalent was
interpolated from linear regression curves (r
0.990)
generated from the standards prepared as previously described
(41), using Kaleidagraph software.
RT-PCR analysis.
Total RNA was prepared from pooled ganglia
by equilibrium centrifugation as previously described (45),
with some modifications. Following centrifugation, approximately 10 to
20 µg of total RNA was incubated with 4 U of RQ-DNase (Promega) and
20 U of RNasin (Promega) in a 40-µl standard reaction mixture for
1 h at 37°C and then extracted with Ultraspec (Biotecx)
according to the manufacturer's protocol. Prior to synthesis of cDNA,
3 µg of total RNA was annealed for 2 h at 65°C in a 12-µl
reaction mixture containing reverse primers specific for the
viral mRNAs encoding ICP4 (5'-GATCCCCCTCCCGCGCTTCGTCCG-3'), gC (5'-CGTTAGGTTGGGGGCGCT-3'), LAT
(5'-ACGAGGGAAAACAATAAGGG-3'), and the cellular
-actin
(5'-CCAGGGAGGAAGAGGATGCGGC-3') (44, 45). Reverse
primers for the viral mRNAs encoding ICP27
(5'-TGTGGGGCGCTGGTTGAGGAT-3'), TK
(5'-AGGGGGTACGAAGCCATACGCGCTT-3'), and UL42
(5'-CGTGATCGCCAACTCCA-3') were also included in the 12-µl
annealing mix. Half of the annealed RNA was reverse transcribed in a
20-µl reaction mixture containing 1 mM deoxynucleoside triphosphates
(dNTPs) and avian myeloblastosis virus RT (Promega); the other half was
incubated in an identical reaction mixture containing no RT. One-tenth
of each mixture (with and without RT) was subjected to PCR for ICP4,
TK, and gC, and 1/200 was used for the PCR amplification of LAT
and
-actin. The primer sets and optimal PCR conditions for ICP4, TK,
gC, LAT, and
-actin were as previously described (45),
with minor changes to the PCRs for TK and
-actin. The PCR
amplification of the 103-bp TK-specific product was optimal in the
presence of 1.5 mM Mg2+, 10% glycerol, and 5% dimethyl
sulfoxide, and the PCR for
-actin contained no additives. The PCRs
for ICP27 and UL42 included the reverse primers listed above with the
forward primers for ICP27 (5'GCCGCGACGACCTGGAAT3') and UL42
(5'GGAATCCTACAGGCGTTTGC3'). These reactions were optimized
by the addition of 10% glycerol and of 10% glycerol plus 5% dimethyl
sulfoxide, respectively. To amplify the 218-bp ICP27- and the 263-bp
UL42-specific products, 1/10 of the cDNA was subjected to 30 cycles of
1-min denaturing at 95°C, 1-min annealing at 55°C, and 1-min
extension at 72°C. All PCRs were done in a 100-µl volume containing
1× PCR buffer (Boehringer Mannheim Biochemicals), 200 µM dNTPs, and
2.5 U of Taq polymerase (Boehringer Mannheim Biochemicals).
For the ICP4 PCR, 2.5 U of Amplitaq Gold (Perkin-Elmer) was substituted
for Taq polymerase (Boehringer Mannheim Biochemicals).
The PCR products were separated on native 8% polyacrylamide-TBE gels,
electrophoretically transferred to nylon membranes (GeneScreen
Plus;
NEN), UV cross-linked, and subsequently probed with
32P-end-labeled internal probes specific for ICP4, TK, gC,
LAT,
and

-actin as previously described (
44,
45). The
internal
probes used to detect the ICP27 and UL42 PCR products were
5'-AGCACCCAGACGCCTCGTCCGACGGA-3'
and
5'-TCCATAACACGATCTTTGGGGAGCAGGTG-3', respectively. The
resulting
blots were exposed to X-ray film and quantitatively analyzed
with
an Ambis Radioanalytic Imager. Because the LAT RT-PCR signal
varied
greatly between different viruses over time, the following
experiment
was used to demonstrate the linearity of the LAT RT-PCR
conducted
in the context of this study. cDNA from KOS-infected ganglia
at
30 days postinfection was serially diluted in cDNA from
mock-infected
ganglia by 0.5-log dilutions over 3 orders of magnitude.
This
preparation was subjected to PCR, analyzed by Southern blotting,
quantified, and plotted as counts versus dilution. Over the 1,000-fold
range tested, a linear relationship was obtained.
 |
RESULTS |
The acute growth phenotypes of mutants within the serine-rich
region of ICP4.
Identification of the residues responsible for the
neuron-specific growth defect of the mutant d8-10
(77) required making finer mutations within this region of
ICP4. As illustrated in Fig. 1A, the sequences most conserved among the
alphaherpesviruses are the polyserine tract and several residues
constituting a consensus site for CKII. To address the
contributions of these sites to viral growth, mutations were
introduced at each site as described in Materials and Methods. The
SER mutation deleted the polyserine tract, and the
CKII
mutation deleted the CKII consensus site by
replacing the acidic residues of the consensus site with alanines (Fig.
1A). Two additional viruses were constructed as controls. Mutant
vi8-i10 contained the wt sequences along with the same i8 and i10
insertions exploited in the construction of the
SER mutant. The
virus r
SER was isolated following transfection of
SER viral DNA
with the 1.84-kb BamHI Y fragment encoding the first 521 aa
of ICP4 (Fig. 1A) and screening for repair of the
SER mutation.
Southern blot analysis (Fig.
1B) confirmed the introduction of the

SER and CKII

mutations in both copies of ICP4 by
demonstrating the insertion
of new restriction sites (
MluI
and
BspE1, respectively) as well
as the loss of the
HpaI site present in the n12 (parental) virus
(
17). The vi8-i10 mutant contains the same i8 and i10
mutations
as

SER, as indicated by the corresponding
PstI
restriction sites
(
68). The loss of the
MluI and
PstI sites from r

SER (Fig.
1C)
confirms the rescue of the
serine tract mutation.
The

SER and CKII

mutants and control viruses were
analyzed, along with the wt virus KOS and the mutant
d8-10,
for the ability
to grow in Vero cells and for effects on viral gene
expression.
As previously described,
d8-10 grows in tissue
culture with reduced
viral yields (
68,
69,
77). To compare
the growth deficiency
of
d8-10 with any imparted by the

SER and CKII

mutations, Vero cells were infected with
each virus at an MOI
of 5 PFU per cell, and viral yields were
determined by plaque
assay on E5 cells. The

SER and
CKII

viruses demonstrated greater viral yields than
d8-10 (Table
1).
The ranges of
viral yields (burst sizes) over four experiments
were as follows; 45 to
72 for
d8-10, 130 to 360 for

SER, 300
to 700 for
CKII

, and 600 to 840 for KOS. The yields for vi8-i10 and
r

SER were
similar to those for KOS, indicating that the i8 and i10
mutations
or mutations outside the 1.84-kb
BamHI-Y loci of

SER did not
significantly impair viral growth.
The

SER and CKII

mutants exhibited only slightly
reduced growth in tissue culture compared to KOS. Accordingly, both
viruses
demonstrated polypeptide profiles (Fig.
2) at early and late times
postinfection
that were very similar to those of KOS, while the
more growth-deficient
d8-10 virus resulted in a delayed pattern
of gene
expression, consistent with previous findings (
68,
69,
77).

View larger version (117K):
[in this window]
[in a new window]
|
FIG. 2.
Polypeptide profiles of the serine tract mutants. Vero
cells were infected (MOI of 10) with the indicated viruses, pulsed with
[35S]methionine at the indicated times postinfection, and
processed for SDS-PAGE analysis on an SDS-9% polyacrylamide gel. The
positions of selected viral proteins are designated.
|
|
The main focus of this study is to identify the elements within the
region deleted in
d8-10 that are responsible for the growth
deficiency in the trigeminal ganglia. The murine eye model was
used to
assess the growth phenotypes in vivo of viruses with mutations
in
the serine-rich region. Mice were infected via corneal scarification
with either

SER, CKII

,
d8-10, or KOS as
described in Materials and Methods. Growth
in the eye was quantified
from eye swab samples collected at 1
day postinfection, and growth in
the trigeminal ganglia was quantified
from ganglion homogenate samples
collected and prepared 3 days
postinfection. Table
2 summarizes the growth phenotypes of the
viruses in the eye and in the trigeminal ganglia from several
experiments. In the eye, the viruses had a growth profile similar
to
that observed in Vero cells (Table
1), in that

SER and
CKII

were not as deficient for growth as
d8-10
but not as vigorous
as KOS. However, the growth characteristics of the
viruses in
the trigeminal ganglia differed dramatically. While the
CKII

virus yields in the ganglia were approximately
30-fold lower
than the wt yields, the

SER yields were very similar
to that
of
d8-10 in that very few harvested ganglia yielded
any infectious
virus, with the average yield being more than
10
3-fold lower than that of KOS (Table
2). These results
indicated
that the polyserine tract was the element within the
serine-rich
region contributing specifically to growth in the
trigeminal ganglia.
Additional support of this conclusion comes from
the growth phenotypes
of vi8-i10 and r

SER. Both vi8-i10 and r

SER
demonstrated a growth
phenotype similar to that of KOS in the eye and
in the trigeminal
ganglia, indicating again that the

SER mutation
was responsible
for the severe growth defect observed in ganglia.
SER DNA replicates poorly in the trigeminal ganglia yet
establishes latent infection.
To address the block in
lytic growth of the
SER mutant in the trigeminal ganglia, a
more detailed study of viral replication was initiated. Mice were
infected with
SER or the wt virus, and ganglia were harvested at
selected time points over a 30-day period postinfection. Viral DNA
content (load) at each time interval was determined by quantitative PCR
(41). Figure 3 graphically illustrates the data, each data point representing the viral load of an
individual ganglion. As shown,
SER DNA was detected in the ganglia
as early as 33 h postinfection, with the viral load peaking at
56 h (Fig. 3). By 7 days, the viral load had generally decreased
in the
SER-infected ganglia, approaching the levels observed at 30 days postinfection. In contrast, the wt-infected ganglia
demonstrated at 56 h a viral load greater than that observed for
SER, and this increased viral load was relatively unchanged at 7 days postinfection.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
Accumulation of viral DNA in SER- and KOS-infected
ganglia. Viral DNA content at the designated time points in KOS- or
SER-infected trigeminal ganglia was determined by PCR as described
in Materials and Methods (41). Each data point was
determined from an individual ganglion.
|
|
Collectively, these data indicate that the

SER virus probably did
not replicate in the trigeminal ganglia. While it cannot
be ruled out
that the increased viral load at 56 h postinfection
in the

SER-infected ganglia represents low levels of viral replication,
it
may simply reflect increased load due to the retrograde transport
of
virus still growing at peripheral sites of infection. By 7
days
postinfection, with the peripheral infection resolving, the
viral load
in the ganglia may be a better representation of viral
replication
occurring at that site.
It has been shown that replication in the trigeminal ganglia is not
required for establishment of latency (
10,
23,
41,
51) and
that
d8-10 establishes latent infection (
77). The
ability of the viruses constructed for this study to establish
latent
infection was determined by two methods; the first measured
the viral
DNA content directly by determining the genome copy
number at 30 days
postinfection, and the second determined the
efficiency of reactivation
as an indicator of previously latent
virus. Quantitative PCR
(
41) was used to determine the DNA copy
number in latently
infected trigeminal ganglia. As summarized
in Table
3, the average viral load in

SER-infected ganglia was
about 10-fold lower than the viral load in
wt-infected ganglia,
while the viral load in
d8-10-infected ganglia was further reduced.
As expected, the
viral load in r

SER-infected ganglia was more
similar to that in
KOS-infected ganglia. Explant reactivation
assays (
51) were
also performed at 30 days postinfection for
mice infected with
d8-10,

SER, CKII

, r

SER, and KOS;
percentages of explanted ganglia that yielded
infectious virus are
shown in Table
3. These results are noteworthy
only in that the ability
of the mutants to reactivate confirms
the establishment of
latency and the presence of intact genomes
in ganglia at 30 days
postinfection. The frequency of reactivation
for
d8-10 agrees with that previously reported for this mutant
(
77).
Viral gene expression in
SER-infected ganglia.
To determine
where in the lytic cycle the
SER mutation affected viral
growth in neurons, viral gene expression in the trigeminal ganglia was analyzed by quantitative RT-PCR (45). Included
in the analyses were KOS and a tk mutant, dlsptk
(10), a virus with a well-characterized defect for growth in
the trigeminal ganglia (10, 41, 43, 45). In this set of
experiments, ganglia from infected mice were harvested at 56 h, 7 days, and 30 days postinfection. Six ganglia from each time point were
pooled, an aliquot of each pooled sample was processed for DNA to
determine viral DNA content (41), and the remainder was
processed for RT-PCR. Primers specific for the viral genes encoding
ICP4, ICP27, TK, UL42, gC, and LAT and for the cellular
-actin gene
(44, 45) were used for the synthesis and amplification of
cDNA. The PCR products were separated on native polyacrylamide gels and transferred to Nytran membranes. Gene-specific products were identified by Southern blot analysis using radiolabeled oligonucleotide probes.
The RT-PCR analysis of viral gene expression during the acute infection
is shown in Fig.
4. Signals for all
amplified messages
were readily detected for the replication-deficient
mutants

SER
and
dlsptk, except for those of UL42 and gC,
which approached
the level of detection, especially at 7 days
postinfection. Consistent
with observations made by Kosz-Vnenchak et
al. (
43) and Nichol
et al. (
56), the levels of
ICP4 and ICP27 signals detected from
the infected ganglia relative to
viral DNA content indicate that
expression of ICP4 and ICP27 in
dlsptk was lower per genome than
that in the wt virus. The
level of ICP4 per genome in

SER was
lower than that observed for the
dlsptk mutant at 56 h and 7 days
postinfection. In
contrast, ICP27 expression in

SER was similar
to that in
dlsptk at 56 h postinfection; however, it was reduced
compared to that in
dlsptk at 7 days postinfection.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Viral gene expression in the trigeminal ganglia during
acute infection. RT-PCR products of viral and cellular transcripts from
ganglia infected with SER, KOS, or the tk mutant dlsptk
(10) from pooled ganglia harvested at 56 h and 7 days
postinfection are shown. PCR products of viral DNA (vDNA) for each
sample are also shown along with the PCR signals used to establish a
viral DNA standard curve. ACT, -actin.
|
|
The reduced abundance of ICP4 mRNA during the acute infection in

SER
did not appear to greatly affect the level of
tk per
genome
relative to
dlsptk. Although the
tk signal is
lower in

SER than in
dlsptk, the two mutants demonstrated
similar ratios
of
tk to ICP4 signal, indicating that the

SER mutation in ICP4
does not abrogate its ability to activate
tk, a gene whose expression
stringently depends on ICP4
(
16,
19,
30,
38,
57). Expression
of another E gene, UL42, in

SER and
dlsptk during the acute infection
appears to be
more restricted than the expression of
tk. While
UL42 was
easily detected in KOS at 56 h and 7 days, very little
UL42 was
detected in the

SER and
dlsptk samples. Again, consistent
with their ICP4 RT-PCR profiles, the

SER UL42 signal was lower
than
that from the
dlsptk-infected ganglia and hence does not
reveal any obvious difference in UL42 expression between the mutants.
RT-PCR analysis of L gene expression supports the observation that

SER and
dlsptk are not replicating. As a true late gene,
expression of the gC gene is dependent on viral replication (
39,
42,
52). It might be expected that if

SER and
dlsptk were
not replicating, no gC would be detected. Barely
detectable levels
of gC were detected in the

SER- and
dlsptk-infected ganglia at
56 h postinfection, and no
gC was detected at 7 days postinfection.
It may be that the small
amount of gC detected is due to read-through
transcription from a 5' E
gene as previously hypothesized by Kramer
et al. to explain the
presence of small amounts of gC signal in
dlsptk-infected
ganglia (
44,
46). Alternatively, the low expression
of gC
may indicate that there is very low level viral DNA synthesis
in the

SER- and
dlsptk-infected ganglia.
Perhaps the most interesting observation regarding viral gene
expression in the trigeminal ganglia relates to the expression
of
LAT. At 56 h postinfection, the LAT signal per genome in the

SER- and
dlsptk-infected ganglia was greater than that
observed
in the wt-infected ganglia (see Fig.
6). It is also
interesting
that despite the 10- to 30-fold increase in LAT expression
in
the mutant-infected ganglia, LAT expression at 56 h was lower
in

SER than in
dlsptk. By 7 days, there was no difference
in
LAT expression in the

SER- and
dlsptk-infected
ganglia. These
levels were still greater on a per-genome basis than the
amount
of LAT per viral DNA content observed in wt-infected ganglia (8-
to 10-fold).
During latency, while expression of the acute viral genes is difficult
to detect (
45,
72), the LAT transcript is abundantly
expressed (
13,
14,
64,
70,
72). At 30 days postinfection,
the levels of LAT detected in the mutant- and wt-infected ganglia
per
genome were very similar (Fig.
5).
Therefore, as illustrated
in Fig.
6, LAT
expression per genome was initially greater and
peaked earlier in the

SER- and
dlsptk-infected ganglia than in
the wt-infected
ganglia. By 30 days postinfection, the difference
was no longer
apparent.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 5.
LAT expression at 30 days postinfection. RT-PCR products
of LAT and -actin (ACT) prepared from ganglia infected with the
designated viruses and harvested at 30 days postinfection are shown in
the top two panels. The bottom panel shows the PCR products of viral
DNA (vDNA) for each virus. These data represent an animal experiment
different from that used for Fig. 4 but are typical of previous
results.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
LAT expression per genome during acute and latent
infection. The 56-h- and 7-day-postinfection LAT RT-PCR and viral DNA
PCR data from Fig. 4 were combined with the corresponding
30-day-postinfection LAT RT-PCR and viral DNA PCR data to illustrate
LAT expression per genome as a function of time. As the absolute amount
of LAT was not quantitatively determined with standards, the LAT RT-PCR
signal per genome is represented simply as net counts per genome.
|
|
 |
DISCUSSION |
Viral mutants in which the serine-rich region (aa 143 to 210) of
ICP4 is deleted exhibit reduced viral yields and delayed E and L gene
synthesis in tissue culture but demonstrate a total block for
replication in the trigeminal ganglia of infected mice. This result
suggested that this region of ICP4 is necessary for the progression of
lytic infection in neurons. In this study, we conducted a finer
mutational analysis of the region and isolated a mutant whose phenotype
strengthens and confirms this hypothesis. Specifically, a mutant in
which only the highly conserved polyserine residues (aa 184 to 198)
have been deleted,
SER, exhibited a more restored growth phenotype
in tissue culture and at peripheral sites of infection in mice but
continued to exhibit the restricted lytic growth in the mouse
trigeminal ganglia characteristic of a mutant with the entire region
(aa 143 to 210) deleted (68, 69, 77). This phenotype
suggested that the polyserine residues comprise an element embedded
within ICP4 required for the protein to function properly during lytic
infection of neuronal tissue.
The
SER mutant demonstrated a defective growth phenotype in the
trigeminal ganglia of mice. The gene expression profile of
SER in
the trigeminal ganglia was similar to, if not somewhat more impaired
than, that of a tk mutant, dlsptk. This finding indicates that
SER infection was blocked at a similar point in lytic
growth as dlsptk. While the dlsptk mutant does
not replicate in the ganglia, presumably because it cannot supplement
the limiting pools of NTPs, it is not clear why
SER is blocked for
viral replication.
The RT-PCR data of
SER-infected ganglia indicated that both ICP4 and
ICP27 were present. Furthermore, the
SER mutation did not appear to
impair the ability of ICP4 to activate tk. UL42 was also
present at low levels. In fact, tk and UL42 expression in
SER-infected ganglia was similar to that observed in
dlsptk-infected ganglia, considering their corresponding
ICP4 RT-PCR signals. In light of the similar phenotypes of these
mutants, it is noteworthy that the wt phenotype of the rescued
SER
virus as well as the acyclovir sensitivity of
SER confirmed that the
defective phenotype was due to a mutation in ICP4, not in
tk. While the tk and UL42 expression profiles of
SER did not explain the block in replication, the extremely low
expression of gC and the PCR analysis of viral genomes in the infected
ganglia indicated that somewhere between E gene expression and viral
replication, the
SER mutation inhibited the progression of lytic
growth in neurons.
While tk expression is considered an excellent indicator of
ICP4 function, there are ICP4 mutants that are capable of activating tk in the context of viral infection yet fail to replicate
(68). n208, a mutant in which the carboxy-terminal
activation domain of the protein has been deleted (68),
exhibits activated levels of some early genes like tk but
not others (67). Consequently, E genes are not homogeneous
with respect to activation by ICP4. Additionally, activation of some E
genes, like UL9 and UL30, may be further complicated by their unusual
sensitivity to the status of DNA replication (4, 74). There
is also the possibility that some E genes are differentially regulated
in neurons; for example, the UL9 promoter has been reported to contain
a cyclic AMP response element and to be differentially induced in PC12 cells (14). Perhaps in neurons, the requirements for ICP4
activation are more stringent for a particular subset of E genes,
requiring an activity which is lacking in the
SER ICP4 protein.
Thus, while differential activation of the E genes is one hypothesis
for the block in lytic growth in
SER-infected ganglia, the available RT-PCR data (as well as in vitro data) suggest that the
SER ICP4 retains some activation function. Last, it may be that the
SER mutation simply reduces the activation function of ICP4 such that it is
not readily noticeable in cell culture beyond a slight reduction in
viral yield. However, in neurons, some specific promoters may not be as
responsive to ICP4, and thus the defect imparted by the
SER mutation
would have greater consequences for the expression of such genes.
Another function of ICP4 which the RT-PCR data suggest is intact in the
SER protein is its ability to repress ICP4 and LAT. In fact, the
56-h postinfection data (Fig. 4) might suggest that the
SER mutation
enhanced repression of these two genes, given their reduced abundance
in the
SER-infected ganglia. Another viral product known to be
repressed by ICP4 is the L/ST (open reading frame [ORF] P) transcript
(5, 49, 78). We were unsuccessful in detecting the ORF P
transcript by RT-PCR. The level of ORF P transcript may be relevant in
that it has been shown to repress expression of the neurovirulence
factor
34.5 (50). However, in this case less
neurovirulence is associated with the derepression of ORF P
(50). As is the case for activation, the serine tract region
does not appear to greatly affect repression in tissue culture or in
vitro (35, 36, 65). Thus, if repression was affected by the
SER mutation, it would have to be an effect specific to function in
neurons.
A less likely possibility is that the
SER mutation does not permit
ICP4 to act more directly at the level of DNA replication. Although
ICP4 does not participate in origin-dependent DNA synthesis in cell
culture (75), perhaps its function as a transcriptional activator induces local changes in the viral genome that result in more
efficient replication in neurons. In neurons, the converse seems to be
true; viral replication enhances the transcriptional activation of the
lytic genes (43, 56).
An interesting result from this study relates to the expression profile
of LAT. LAT expression in
SER and dlsptk during the acute
infection in ganglia was substantially greater (per genome) than in
KOS, but by 30 days postinfection this difference was no longer
apparent. The increased LAT expression during acute times in
SER-
and dlsptk-infected ganglia may partly be a function of less
ICP4 being expressed, as ICP4 has been shown to repress expression of
LAT (3, 4, 62). Another possibility may be that LAT is
expressed only from genomes in which lytic infection had either never
initiated or already been aborted. This scenario predicts a population
of
SER and dlsptk viruses that were no longer expressing
the lytic genes and were essentially latent.
The robust expression of LAT in the replication-deficient mutants
appears to be coincident with the reduced expression or silencing of
lytic gene expression and has been hypothesized to be one mechanism by
which to silence expression of the lytic genes (7, 27). As
described by Garber et al. (27) and Chen et al.
(7), LAT expression is associated with a decreased
accumulation of ICP4 and tk transcripts. Down-regulating the
lytic cycle genes would be a mechanism to slow the progression of
productive infection. In the case of
SER and dlsptk, the
block in replication prevents full expression of the IE and E genes.
This, in combination with the earlier and more abundant expression of
LAT, may expedite the process of achieving latency. In the KOS-infected
ganglia, achieving this state is a more protracted process, perhaps
because viral replication allows the IE genes to be fully induced,
leading to lower LAT expression (3, 4, 62). Although
replication-deficient mutants such as
SER and dlsptk
establish latent infection with a lower viral genome burden, the
numbers change very little during the acute and latent infection
(44), whereas during acute times, wt-infected ganglia
typically contain 10 to 100 times the number of genomes at latency.
Therefore, if we define the efficiency of establishing latency as the
percentage of genomes retained in the trigeminal ganglia, then
SER
and dlsptk are more efficient at establishing latent
infection.
The polyserine tract of ICP4 is conserved in many of the neurotropic
herpesvirus ICP4 homologs and is required for growth in the trigeminal
ganglia but is otherwise unremarkable for its effect on ICP4 function
in Vero cells or in vitro. One possible explanation for the viral
growth advantage specified by these residues may be that the polyserine
residues directly complement a coactivator function that is missing or
limiting in neuronal cells but is abundantly expressed in nonneuronal
cells. It is also possible that these residues influence the activities
of ICP4 in neurons as a function of phosphorylation of the ICP4 protein via modification by neuronal kinases and/or phosphatases. Both scenarios predict that this region is important in regulating the
activity of ICP4 in neurons and in part helps determine whether the
virus replicates or assumes a state that favors the establishment of
latency.
 |
ACKNOWLEDGMENTS |
We thank Colton Smith and Lorna Samaniego for helpful discussions
and comments on the manuscript.
This work was supported by NIH grant AI27431.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: E1257 Biomedical
Science Tower, Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261. Phone: (412) 648-9947. Fax: (412) 624-1401. E-mail:
neal{at}hoffman.mgen.pitt.edu.
 |
REFERENCES |
| 1.
|
Anderson, A. S.,
A. Francesconi, and R. W. Morgan.
1992.
Complete nucleotide sequence of the Marek's disease virus ICP4 gene.
Virology
189:657-667[Medline].
|
| 2.
|
Baradaran, K.,
C. E. Dabrowski, and P. A. Schaffer.
1994.
Transcriptional analysis of the region of the herpes simplex virus type 1 genome containing the UL8, UL9, and UL10 genes and identification of a novel delayed-early gene product, OBPC.
J. Virol.
68:4251-4261[Abstract/Free Full Text].
|
| 3.
|
Batchelor, A. H., and P. O'Hare.
1990.
Regulation and cell-type-specific activity of a promoter located upstream of the latency associated transcript of herpes simplex virus type 1.
J. Virol.
64:3269-3279[Abstract/Free Full Text].
|
| 4.
|
Batchelor, A. H., and P. O'Hare.
1992.
Localization of cis-acting sequence requirements in the promoter of the latency-associated transcript of herpes simplex virus type 1 required for cell-type-specific activity.
J. Virol.
66:3573-3582[Abstract/Free Full Text].
|
| 5.
|
Bohenzky, R. A.,
A. G. Papavassiliou,
I. H. Gelman, and S. Silverstein.
1993.
Identification of a promoter mapping within the reiterated sequences that flank the herpes simplex virus type 1 UL region.
J. Virol.
67:632-642[Abstract/Free Full Text].
|
| 6.
|
Carrozza, M. J., and N. A. DeLuca.
1996.
Interaction of the viral activator protein ICP4 with TFIID through TAF250.
Mol. Cell. Biol.
16:3085-3093[Abstract].
|
| 7.
|
Chen, S.,
M. F. Kramer,
P. A. Schaffer, and D. M. Coen.
1997.
A viral function represses accumulation of transcripts from productive-cycle genes in mouse ganglia latently infected with herpes simplex virus.
J. Virol.
71:5878-5884[Abstract].
|
| 8.
|
Cheung, A. K.
1989.
DNA nucleotide sequence analysis of the immediate-early gene of pseudorabies virus.
Nucleic Acids Res.
17:4637-4646[Abstract/Free Full Text].
|
| 9.
|
Chou, J.,
E. R. Kern,
R. J. Whitley, and B. Roizman.
1990.
Mapping of herpes simplex virus-1 neurovirulence to 134.5, a gene nonessential for growth in culture.
Science
250:1262-1266[Abstract/Free Full Text].
|
| 10.
|
Coen, D. M.,
M. Kosz-Vnenchak,
J. G. Jacobson,
D. A. Leib,
C. L. Bogard,
P. A. Schaffer,
K. L. Tyler, and D. M. Knipe.
1989.
Thymidine kinase-negative herpes simplex virus mutants establish latency in mouse trigeminal ganglia but do not reactivate.
Proc. Natl. Acad. Sci. USA
86:4736-4740[Abstract/Free Full Text].
|
| 11.
|
Cook, M. L.,
V. B. Basatone, and J. G. Stevens.
1974.
Evidence that neurons harbor latent herpes virus.
Infect. Immun.
9:946-951[Abstract/Free Full Text].
|
| 12.
|
Courtney, R. J., and M. Benyesh-Melnick.
1974.
Isolation and characterization of a large molecular weight polypeptide of herpes simplex virus type 1.
Virology
62:539-551[Medline].
|
| 13.
|
Croen, D. D.,
J. M. Ostrove,
L. J. Dragovic,
J. E. Smialec, and S. E. Straus.
1987.
Latent herpes simplex virus in human trigeminal ganglia: detection of an immediate early gene "anti-sense" transcript by in situ hybridization.
N. Engl. J. Med.
317:1427-1431[Abstract].
|
| 14.
|
Deatly, A. M.,
J. G. Spivack,
E. Lavi, and N. W. Fraser.
1987.
RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia in latently infected mice.
Proc. Natl. Acad. Sci. USA
84:3204-3208[Abstract/Free Full Text].
|
| 15.
|
Deb, S. P.,
S. Deb, and D. R. Brown.
1994.
Cell-type-specific induction of the UL9 gene of HSV-1 by cell signaling pathway.
Biochem. Biophys. Res. Commun.
205:44-41[Medline].
|
| 16.
|
DeLuca, N. A.,
M. A. Courtney, and P. A. Schaffer.
1984.
Temperature-sensitive mutants in herpes simplex virus type 1 ICP4 permissive for early gene expression.
J. Virol.
52:767-776[Abstract/Free Full Text].
|
| 17.
|
DeLuca, N. A.,
A. McCarthy, and P. A. Schaffer.
1985.
Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4.
J. Virol.
56:558-570[Abstract/Free Full Text].
|
| 18.
|
DeLuca, N. A., and P. A. Schaffer.
1985.
Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4.
Mol. Cell. Biol.
5:1997-2008[Abstract/Free Full Text].
|
| 19.
|
DeLuca, N. A., and P. A. Schaffer.
1987.
Activities of herpes simplex virus type 1 (HSV-1) ICP4 genes specifying nonsense peptides.
Nucleic Acids Res.
15:4491-4511[Abstract/Free Full Text].
|
| 20.
|
DeLuca, N. A., and P. A. Schaffer.
1988.
Physical and functional domains of the herpes simplex virus transcriptional regulatory protein ICP4.
J. Virol.
62:732-743[Abstract/Free Full Text].
|
| 21.
|
DiDonato, J. A.,
J. R. Spitzner, and M. R. Muller.
1991.
A predictive model of DNA recognition by herpes simplex virus protein ICP4.
J. Mol. Biol.
219:451-470[Medline].
|
| 22.
|
Dixon, R. A. F., and P. A. Schaffer.
1980.
Fine-structure mapping and functional analysis of temperature-sensitive mutants in the early gene encoding the herpes simplex virus type 1 immediate-early protein VP175.
J. Virol.
36:189-203[Abstract/Free Full Text].
|
| 23.
|
Efstathiou, S.,
A. C. Minson,
H. J. Field,
J. R. Anderson, and P. Wildy.
1986.
Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.
J. Virol.
57:446-455[Abstract/Free Full Text].
|
| 24.
|
Everett, R. D.
1984.
Transactivation of transcription by herpes virus products: requirement for two HSV-1 immediate early polypeptides for maximum activity.
EMBO J.
3:3135-3141[Medline].
|
| 25.
|
Everett, R. D., and M. L. Fenwick.
1990.
Comparative DNA sequence of the host shutoff genes of different strains of herpes simplex virus: type 2 strain HG52 encodes a truncated UL41 product.
J. Gen. Virol.
73:2167-2171[Abstract/Free Full Text].
|
| 26.
|
Faber, S. W., and K. W. Wilcox.
1986.
Association of the herpes simplex virus regulatory protein ICP4 with specific nucleotide sequences.
Nucleic Acids Res.
14:6067-6083[Abstract/Free Full Text].
|
| 27.
|
Garber, D. A.,
P. A. Schaffer, and D. M. Knipe.
1997.
A LAT-associated function reduces productive-cycle gene expression during acute infection of murine sensory neurons with herpes simplex virus type 1.
J. Virol.
71:5885-5893[Abstract].
|
| 28.
|
Garcia-Blanco, M. A., and B. R. Cullen.
1991.
Molecular basis of latency in pathogenic human viruses.
Science
254:815-820[Abstract/Free Full Text].
|
| 29.
|
Ge, J., and R. G. Roeder.
1994.
Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes.
Cell
78:513-523[Medline].
|
| 30.
|
Gelman, I. H., and S. Silverstein.
1985.
Identification of immediate early genes from herpes simplex virus that transactivate the virus thymidine kinase gene.
Proc. Natl. Acad. Sci. USA
83:5265-5269.
|
| 31.
|
Godowski, P. J., and D. M. Knipe.
1986.
Transcriptional control of herpes virus gene expression: gene functions required for positive and negative regulation.
Proc. Natl. Acad. Sci. USA
83:256-260[Abstract/Free Full Text].
|
| 32.
|
Gray, W. L.,
N. J. Gusick,
C. Ek-Kommonen,
S. E. Kempson, and T. M. Fletcher, III.
1995.
The inverted repeat regions of the simian varicella virus and varicella-zoster virus genomes have a similar genetic organization.
Virus Res.
39:181-193[Medline].
|
| 33.
|
Grundy, F. J.,
R. P. Baumann, and D. J. O'Callaghan.
1989.
DNA sequence and comparative analyses of the equine herpesvirus type 1 immediate early gene.
Virology
172:223-236[Medline].
|
| 34.
|
Gu, B., and N. A. DeLuca.
1994.
Requirements for activation of the herpes simplex virus glycoprotein C promoter in vitro by the viral regulatory protein ICP4.
J. Virol.
68:7953-7965[Abstract/Free Full Text].
|
| 35.
|
Gu, B.,
R. Kuddus, and N. A. DeLuca.
1995.
Repression of activator-mediated transcription by herpes simplex virus via a mechanism involving interactions with the basal transcription factors TATA-binding protein and TFIIB.
Mol. Cell. Biol.
15:3618-3626[Abstract].
|
| 36.
|
Gu, B.,
R. Rivera-Gonzalez,
C. A. Smith, and N. A. DeLuca.
1995.
Herpes simplex virus infected cell polypeptide 4 preferentially represses Sp1-activated over basal transcription from its own promoter.
Proc. Natl. Acad. Sci. USA
90:9528-9532[Abstract/Free Full Text].
|
| 37.
|
Honess, R. W., and B. Roizman.
1975.
Regulation of herpes virus macromolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides.
Proc. Natl. Acad. Sci. USA
72:1276-1280[Abstract/Free Full Text].
|
| 38.
|
Imbalzano, A. N.,
D. M. Coen, and N. A. DeLuca.
1991.
Herpes simplex virus transactivator ICP4 operationally substitutes for the cellular transcription factor Sp1 for efficient expression of the viral thymidine kinase gene.
J. Virol.
65:565-574[Abstract/Free Full Text].
|
| 39.
|
Johnson, P. A., and R. D. Everett.
1986.
DNA replication is required for abundant expression of a plasmid-borne late US11 gene of herpes simplex virus type 1.
Nucleic Acids Res.
14:3609-3625[Abstract/Free Full Text].
|
| 40.
|
Kaiser, K.,
G. Steizer, and M. Meisterernst.
1995.
The coactivator p15 (PC4) initiates transcriptional activation during TFIIA-TFIID-promoter complex formation.
EMBO J.
14:3520-3527[Medline].
|
| 41.
|
Katz, J. P.,
E. T. Bodin, and D. M. Coen.
1990.
Quantitative polymerase chain reaction analysis of herpes simplex virus DNA in ganglia of mice infected with replication-incompetent mutants.
J. Virol.
64:4288-4295[Abstract/Free Full Text].
|
| 42.
|
Kibbler, P. K.,
J. Duncan,
B. D. Keith,
T. Hupel, and J. R. Smiley.
1991.
Regulation of herpes simplex virus true late gene expression: sequences downstream from the US11 TATA box inhibit expression from an unreplicated template.
J. Virol.
65:6749-6760[Abstract/Free Full Text].
|
| 43.
|
Kosz-Vnenchak, M.,
J. Jacobson,
D. M. Coen, and D. M. Knipe.
1993.
Evidence for a novel regulatory pathway for herpes simplex virus gene expression in trigeminal ganglion neurons.
J. Virol.
67:5383-5393[Abstract/Free Full Text].
|
| 44.
|
Kramer, M. F.,
S. Chen,
D. M. Knipe, and D. M. Coen.
1998.
Accumulation of viral transcripts and DNA during establishment of latency by herpes simplex virus.
J. Virol.
72:1177-1185[Abstract/Free Full Text].
|
| 45.
|
Kramer, M. F., and D. M. Coen.
1995.
Quantification of herpes simplex virus DNA and transcripts during latent infection in mouse trigeminal ganglia by reverse transcriptase PCR. Doctoral dissertation.
Harvard University, Cambridge, Mass.
|
| 46.
|
Kramer, M. F., and D. M. Coen.
1995.
Quantification of transcripts from the ICP4 and thymidine kinase genes in mouse ganglia latently infected with herpes simplex virus.
J. Virol.
69:1389-1399[Abstract].
|
| 47.
|
Kretzschmar, M.,
K. Kaiser,
F. Lottspeich, and M. Meisterernst.
1994.
A novel mediator of class II gene transcription with homology to viral immediate-early transcriptional regulators.
Cell
78:525-534[Medline].
|
| 48.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 49.
|
Lagunoff, M.,
G. Randall, and B. Roizman.
1996.
Phenotypic properties of herpes simplex virus 1 containing a derepressed open reading frame P gene.
J. Virol.
70:1810-1817[Abstract].
|
| 50.
|
Lagunoff, M., and B. Roizman.
1994.
Expression of a herpes simplex virus 1 open reading frame antisense to the 134.5 gene and transcribed by an RNA 3' coterminal with the unspliced latency-associated transcript.
J. Virol.
68:6021-6028[Abstract/Free Full Text].
|
| 51.
|
Leib, D. A.,
D. M. Coen,
C. L. Bogard,
K. A. Hicks,
D. R. Yager,
D. M. Knipe,
K. L. Tyler, and P. A. Schaffer.
1989.
Immediate-early regulatory gene mutants define different stages in the establishment and reactivation of herpes simplex virus latency.
J. Virol.
63:759-768[Abstract/Free Full Text].
|
| 52.
|
Mavromara-Nazos, P., and B. Roizman.
1987.
Activation of herpes simplex virus 1 g2 genes by viral DNA replication.
Virology
161:593-598[Medline].
|
| 53.
|
McGeoch, D. J.,
M. A. Dalrymple,
A. J. Davidson,
A. J. Dolan,
M. C. Frame,
D. McNab,
L. J. Perry,
J. E. Scott, and P. Taylor.
1988.
The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1.
J. Gen. Virol.
69:1531-1574[Abstract/Free Full Text].
|
| 54.
|
McGeoch, D. J.,
A. Dolan,
S. Donald, and D. H. K. Brauer.
1986.
Complete DNA sequence of the short repeat region in the genome of herpes simplex virus type 1.
Nucleic Acids Res.
14:1727-1744[Abstract/Free Full Text].
|
| 55.
|
Metzler, D. W., and K. W. Wilcox.
1985.
Isolation of herpes simplex virus regulatory protein ICP4 as a homodimeric complex.
J. Virol.
55:329-337[Abstract/Free Full Text].
|
| 56.
|
Nichol, P.,
J. Y. Chang,
E. M. Johnson, Jr., and P. D. Olivo.
1996.
Herpes simplex virus gene expression in neurons: viral DNA synthesis is a critical regulatory event in the branch point between the lytic and latent pathways.
J. Virol.
70:5476-5486[Abstract/Free Full Text].
|
| 57.
|
O'Hare, P., and G. S. Hayward.
1985.
Evidence for a direct role for both the 175,000 and 110,000-molecular-weight immediate-early proteins of herpes simplex virus in the transactivation of delayed-early promoters.
J. Virol.
53:751-760[Abstract/Free Full Text].
|
| 58.
|
O'Hare, P., and G. S. Hayward.
1985.
Three trans-acting regulatory proteins of herpes simplex virus modulate immediate-early gene expression in a pathway involving positive and negative feedback regulation.
J. Virol.
56:723-733[Abstract/Free Full Text].
|
| 59.
|
Paterson, R., and R. D. Everett.
1988.
Mutational dissection of the HSV-1 immediate-early protein Vmw-175 involved in transcriptional transactivation and repression.
Virology
166:186-196[Medline].
|
| 60.
|
Paterson, R., and R. D. Everett.
1990.
The regions of the herpes simplex virus type 1 immediate early protein Vmw175 required for site specific DNA binding closely correspond to those involved in transcriptional regulation.
Nucleic Acids Res.
16:11005-11025[Abstract/Free Full Text].
|
| 61.
|
Pereira, L.,
M. H. Wolff,
M. Fenwick, and B. Roizman.
1977.
Regulation of herpes virus macromolecular synthesis. V. Properties of a polypeptide made in HSV-1 and HSV-2 infected cells.
Virology
77:733-749[Medline].
|
| 62.
|
Rivera-Gonzalez, R.,
A. N. Imbalzano,
B. Gu, and N. A. DeLuca.
1994.
The role of ICP4 repressor activity in temporal expression of the IE-3 and latency-associated transcript promoters during HSV-1 infection.
Virology
202:550-564[Medline].
|
| 63.
|
Roberts, M. S.,
A. Boundy,
P. O'Hare,
M. C. Pizzorno,
D. M. Ciufo, and G. S. Hayward.
1988.
Direct correlation between a negative response element at the cap site of the herpes simplex virus type IE175 ( 4) promoter and a specific binding site for the IE175 (ICP4) protein.
J. Virol.
62:4307-4320[Abstract/Free Full Text].
|
| 64.
|
Rock, S. L.,
A. B. Nesburn,
H. Ghiasi,
J. Ong,
T. L. Lewis,
J. R. Lokensgard, and S. L. Wechsler.
1987.
Detection of latency-related viral RNAs in trigeminal ganglia of rabbits infected with herpes simplex virus type 1.
J. Virol.
61:3820-3826[Abstract/Free Full Text].
|
| 65.
|
Samaniego, L. A.,
A. L. Webb, and N. A. DeLuca.
1995.
Functional interactions between herpes simplex virus immediate-early proteins during infection: gene expression as a consequence of ICP27 and different domains of ICP4.
J. Virol.
69:5705-5715[Abstract].
|
| 66.
|
Schwyzer, M.,
C. Vlcek,
O. Menekse,
C. Fraefel, and V. Paces.
1993.
Promoter, spliced leader, and coding sequence for BICP4, the largest of the immediate-early proteins of bovine herpesvirus 1.
Virology
197:349-357[Medline].
|
| 67.
| Shepard, A. A., and N. A. DeLuca.
Unpublished results.
|
| 68.
|
Shepard, A. A.,
A. N. Imbalzano, and N. A. DeLuca.
1989.
Separation of primary structural components conferring autoregulation, transactivation and DNA-binding properties to the herpes simplex virus transcriptional regulatory protein ICP4.
J. Virol.
63:3714-3728[Abstract/Free Full Text].
|
| 69.
|
Smith, C. A.,
P. Bates,
R. Rivera-Gonzalez,
B. Gu, and N. A. DeLuca.
1993.
ICP4, the major transcriptional regulatory protein of herpes simplex virus type 1, forms a tripartite complex with TATA-binding protein and TFIIB.
J. Virol.
67:4676-4687[Abstract/Free Full Text].
|
| 70.
|
Spivack, J. G., and N. W. Fraser.
1987.
Detection of herpes simplex virus type 1 transcripts during latent infection in mice.
J. Virol.
61:3841-3847[Abstract/Free Full Text].
|
| 71.
|
Stevens, J. G., and M. L. Cook.
1971.
Latent herpes simplex virus in spinal ganglia of mice.
Science
173:843-845[Abstract/Free Full Text].
|
| 72.
|
Stevens, J. G.,
E. K. Wagner,
G. B. Devi-Rao, and M. L. Cook.
1987.
RNA complementary to a herpes virus a gene mRNA is prominent in latently infected neurons.
Science
235:1056-1059[Abstract/Free Full Text].
|
| 73.
|
Stevens, J. G.
1994.
Overview of herpesvirus latency.
Semin. Virol.
5:191-196.
|
| 74.
|
Wobbe, K. K.,
P. Digard,
D Staknis, and D. M. Coen.
1993.
Unusual regulation of expression of the herpes simplex virus DNA polymerase gene.
J. Virol.
67:5419-5425[Abstract/Free Full Text].
|
| 75.
|
Wu, C. A.,
N. J. Nelson,
D. J. McGeoch, and M. D. Challberg.
1988.
Identification of the herpes virus type 1 genes required for origin-dependent DNA synthesis.
J. Virol.
62:435-443[Abstract/Free Full Text].
|
| 76.
|
Xia, K.,
N. DeLuca, and D. K. Knipe.
1996.
Analysis of phosphorylation sites of herpes simplex virus type 1 ICP4.
J. Virol.
70:1061-1071[Abstract].
|
| 77.
|
Xia, K.,
D. K. Knipe, and N. DeLuca.
1996.
Role of protein kinase A and the serine-rich region of herpes simplex virus type 1 ICP4 in viral replication.
J. Virol.
70:1050-1060[Abstract].
|
| 78.
|
Yeh, L., and P. A. Schaffer.
1993.
A novel class of transcripts expressed with late kinetics in the absence of ICP4 spans the junction between the long and short segments of the herpes simplex virus type 1 genome.
J. Virol.
67:7373-7382[Abstract/Free Full Text].
|
Journal of Virology, September 1998, p. 7115-7124, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kuddus, R. H., DeLuca, N. A.
(2007). DNA-Dependent Oligomerization of Herpes Simplex Virus Type 1 Regulatory Protein ICP4. J. Virol.
81: 9230-9237
[Abstract]
[Full Text]
-
Miller, C. S., Danaher, R. J., Jacob, R. J.
(2006). ICP0 Is Not Required for Efficient Stress-Induced Reactivation of Herpes Simplex Virus Type 1 from Cultured Quiescently Infected Neuronal Cells.. J. Virol.
80: 3360-3368
[Abstract]
[Full Text]
-
Aleman, N., Quiroga, M. I., Lopez-Pena, M., Vazquez, S., Guerrero, F. H., Nieto, J. M.
(2003). L-Particle Production during Primary Replication of Pseudorabies Virus in the Nasal Mucosa of Swine. J. Virol.
77: 5657-5667
[Abstract]
[Full Text]
-
Tussie-Luna, M. I., Bayarsaihan, D., Ruddle, F. H., Roy, A. L.
(2001). Repression of TFII-I-dependent transcription by nuclear exclusion. Proc. Natl. Acad. Sci. USA
98: 7789-7794
[Abstract]
[Full Text]
-
Preston, C. M.
(2000). Repression of viral transcription during herpes simplex virus latency. J. Gen. Virol.
81: 1-19
[Full Text]
-
Aubert, M., Blaho, J. A.
(1999). The Herpes Simplex Virus Type 1 Regulatory Protein ICP27 Is Required for the Prevention of Apoptosis in Infected Human Cells. J. Virol.
73: 2803-2813
[Abstract]
[Full Text]
-
Zhi, Y., Sandri-Goldin, R. M.
(1999). Analysis of the Phosphorylation Sites of Herpes Simplex Virus Type 1 Regulatory Protein ICP27. J. Virol.
73: 3246-3257
[Abstract]
[Full Text]