Previous Article | Next Article 
J Virol, August 1998, p. 6546-6553, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Template-Dependent Initiation of Sindbis Virus
RNA Replication In Vitro
Julie A.
Lemm,
Anders
Bergqvist,
Carol M.
Read, and
Charles M.
Rice*
Department of Molecular Microbiology,
Washington University School of Medicine, St. Louis, Missouri
63110-1093
Received 2 January 1998/Accepted 5 May 1998
 |
ABSTRACT |
Recent insights into the early events in Sindbis virus RNA
replication suggest a requirement for either the P123 or P23
polyprotein, as well as mature nsP4, the RNA-dependent RNA polymerase,
for initiation of minus-strand RNA synthesis. Based on this
observation, we have succeeded in reconstituting an in vitro system for
template-dependent initiation of SIN RNA replication. Extracts were
isolated from cells infected with vaccinia virus recombinants
expressing various SIN proteins and assayed by the addition of
exogenous template RNAs. Extracts from cells expressing
P123C>S, a protease-defective P123 polyprotein, and nsP4
synthesized a genome-length minus-sense RNA product. Replicase
activity was dependent upon addition of exogenous RNA and was specific
for alphavirus plus-strand RNA templates. RNA synthesis was also
obtained by coexpression of nsP1, P23C>S, and nsP4.
However, extracts from cells expressing nsP4 and P123, a
cleavage-competent P123 polyprotein, had much less replicase activity.
In addition, a P123 polyprotein containing a mutation in the nsP2
protease which increased the efficiency of processing exhibited very
little, if any, replicase activity. These results provide further
evidence that processing of the polyprotein inactivates the
minus-strand initiation complex. Finally, RNA synthesis was detected
when soluble nsP4 was added to a membrane fraction containing
P123C>S, thus providing a functional assay for
purification of the nsP4 RNA polymerase.
 |
INTRODUCTION |
Sindbis virus (SIN), a plus-strand
RNA virus, is the prototype alphavirus (reviewed in reference
37). Upon infection of cells, the genomic
RNA serves as an mRNA and is translated to produce the viral
nonstructural proteins (nsPs) which are necessary for SIN replication.
Viral RNA replication is initiated by the synthesis of a full-length
minus-strand RNA complementary to the genomic 49S plus-strand
RNA. This minus strand then serves as the preferred template for the
synthesis of both 26S subgenomic mRNA and additional
genomic RNA. Three to four hours postinfection, the synthesis
of minus-strand RNA ceases, while the production of plus-strand
genomic and subgenomic RNAs continues throughout the
infectious cycle (32, 33).
The nsPs are translated as two large polyproteins (P123 and P1234),
which are processed by a papain-like protease activity residing in the
C-terminal domain of nsP2 (5, 9), to generate several
intermediate polyproteins and the four individual nsPs (4, 8,
34). These polyproteins and cleavage intermediates, as well as
the mature nsPs, are thought to function as the viral components of the
SIN RNA replication machinery. Evidence suggests that there are
distinct complexes responsible for synthesis of plus- and minus-strand
RNAs and that during SIN infection, proteolytic processing regulates
the composition and template preference of these replication complexes
(18, 35).
Efforts to examine the activity of SIN replication-transcription
complexes with different nsP compositions have mainly involved in vivo
studies of SIN mutants (31, 35) or a vaccinia virus heterologous expression system (16-18). While these
studies have been informative, a cell-free assay could
be extremely useful for studying initiation events and replicase
function. To date, a cell-free system capable of initiating SIN RNA
replication upon addition of exogenous template RNA has not been
reported. Extracts from SIN-infected cells have been shown to elongate
SIN RNAs in vitro; however, direct evidence for de novo initiation was
not obtained (1). The inability to obtain efficient
initiation with a plus-strand template is perhaps not surprising, given
recent in vivo studies that indicate a requirement for either P123 or P23 and mature nsP4 for initiation of minus-strand RNA synthesis (15, 18, 35). These studies also suggest that cleavage at the 1/2 and 2/3 sites switches the template preference of this complex
to minus strands, thus promoting synthesis of plus-strand genomic and subgenomic RNAs and inactivating
minus-strand RNA initiation (18). Previous attempts to
isolate an in vitro system have utilized extracts from SIN-infected
cells containing an active nsP2 protease and may have precluded the
isolation of complexes containing unprocessed P123 or P23 polyproteins
capable of efficient minus-strand initiation. In this paper, using a
heterologous system to express the viral components of the SIN
replicase, we have been able to isolate a crude in vitro system which
can initiate and elongate SIN minus-strand RNA upon addition of
SIN-specific plus-strand template RNA. This system has been used to
examine the requirement for uncleaved polyproteins in the
initiation of minus-strand synthesis.
 |
MATERIALS AND METHODS |
Viruses and cells.
vTF7-3, a vaccinia virus recombinant
which expresses the T7 polymerase (7), was propagated as
previously described (12). The growth conditions for BSC40
cells (12) and BHK-21 cells (16) have been
described previously. Recombinant vaccinia viruses were generated by
marker rescue on CV-1 cells (22), identified and purified by
the gpt selection method (6), and partially purified stocks were grown in BSC40 cells (12).
Infection and preparation of the P15 fraction.
BHK-21
monolayers in 150-mm-diameter tissue culture dishes were infected at a
multiplicity of infection of 10 PFU of each virus per cell in 2.5 ml of
phosphate-buffered saline (PBS) containing 1% fetal calf serum. After
1 h at room temperature, the inoculum was removed and the cells
were incubated at 37°C in minimal essential medium containing 5%
fetal calf serum. At 6 h postinfection, the P15 fraction was
obtained by the isolation procedure of Barton et al. (2),
with minor modifications. Cells were washed with ice-cold PBS, scraped
from the dish in PBS, and collected by centrifugation at 900 × g for 5 min at 4°C. Cell pellets were resuspended in 1 ml
of hypotonic buffer (10 mM Tris-Cl [pH 7.8], 10 mM NaCl), allowed to
swell for 15 min on ice, and disrupted by Dounce homogenization. The
nuclei were removed by pelleting at 900 × g for 5 min
at 4°C, and the postnuclear supernatant was centrifuged at
15,000 × g for 20 min at 4°C. The P15 pellet
isolated from one 150-mm-diameter dish was resuspended in 120 µl of
storage buffer (10 mM Tris-Cl [pH 7.8], 10 mM NaCl, 15% glycerol)
and stored in aliquots at
80°C.
In vitro replication and RNA-dependent RNA polymerase
assays.
Standard reaction mixtures contained 50 mM Tris-Cl (pH
7.8); 50 mM KCl; 3.5 mM MgCl2; 10 mM dithiothreitol; 10 µg of dactinomycin per ml; 5 mM creatine phosphate; 25 µg of
creatine phosphokinase per ml; 1 mM ATP, GTP, and UTP; 0.04 mM CTP; 1.0 mCi of [
-32P]CTP per ml; 800 U of RNasin per ml, 1 µg of template RNA, and 18 µl of the P15 fraction in a total volume
of 50 µl. Reaction mixtures were incubated at 30°C for 60 min and
terminated by the addition of sodium dodecyl sulfate (SDS) to 2.5% and
proteinase K to 100 µg/ml. After extraction with phenol and
chloroform, RNA products were ethanol precipitated, denatured with
glyoxal, and separated by electrophoresis through a 0.8% agarose gel.
Products were visualized by autoradiography of dried gels.
RNase H digestion of RNA products.
32P-labeled
reaction products were denatured for 2 min at 95°C in a buffer
consisting of 2 mM Tris-Cl (pH 7.5), 0.2 mM EDTA, and 80% formamide.
The denatured RNAs were diluted 10-fold and annealed to 150 pmol of
each oligonucleotide in a mixture of 20 mM Tris-Cl (pH 7.5), 100 mM
KCl, and 2.5 µg of tRNA by slow cooling from 80°C to 30°C.
Hybridized oligonucleotides corresponded to the following positions in
the SIN genome sequence: 133 (oligonucleotide a: 7567 to 7585; plus
sense), 4100 (oligonucleotide b; 1003 to 1019; plus sense), 4777 (671 to 686; minus sense), and 10773 (1157 to 1173; minus sense). An equal
volume of digestion buffer (20 mM Tris-HCl [pH 7.5], 100 mM NaCl, 20 mM MgCl2, 20 mM dithiothreitol) was added to half of the
reaction mixture, and digestion with 0.2 U of RNase H was performed for
20 min at 37°C. The RNA fragments were denatured by adding 4 volumes of deionized formamide (final concentration, 80%) and heating
for 2 min at 95°C and then were separated on a 3.5%
urea-polyacrylamide gel and visualized by autoradiography.
Template RNAs.
pJNTSCATX, which contains a unique 3'
XhoI site for production of runoff transcripts, was
constructed by replacing the BglI-NsiI fragment
of pJNTSCAT (20) with the corresponding fragment from pToto1101 (30). To generate capped RNA transcripts which
served as substrate RNAs, plasmid pJNTSCATX was linearized with
XhoI and used for in vitro transcription with SP6 polymerase
as described previously (23). The resulting RNAs contained a
3'-terminal poly(A) tract of 37 residues followed by the sequence
5'-GGGAATTCCTCGA-3'.
To generate a plus-sense SIN substrate RNA with an authentic 3' poly(A)
tract, an adapter containing sites for the restriction endonucleases
BsgI and BseRI was inserted downstream of the
poly(A) sequence in pJNTSCATX. The resulting plasmid, designated
pJNTSCATX(+), has the sequence 5'-CTCCTCTGCACATGGGCCG-3'
inserted between the EcoRI and the XhoI
sites at positions 2948 and 2954, respectively, of pJNTSCATX
[downstream of the 3' poly(A) tract]. Linearization with
BsgI permits synthesis of runoff transcripts terminating with a 34-residue poly(A) tract. By using alternative runoff sites, pJNTSCATX(+) was also used to produce transcripts with truncated or
extended 3'-terminal sequences, as indicated in the Results.
To produce a minus-sense substrate RNA for the SIN replicase, the
plasmid pJNTSCATX(

) was made by PCR amplification of pJNTSCATX
with
primers 5'-CAA
CTCGAggtaccATTGACGGCGTAGT-3'
(oligonucleotide
265) and
5'-CAC
GAGCTCTAATACGACTCACTATAGGGTT
31-3'
(oligonucleotide
305). The resulting PCR product was digested
with
SacI and
XhoI
(sites shown in italics) and
cloned into the corresponding sites
of pJNTSCATX to create a T7
promoter (underlined) and the minus-sense
strand of pJNTSCATX(+),
followed by a
KpnI site (lowercase) for
production of runoff
transcripts with an authentic 3'-terminal
G residue (
39).
Three G residues were inserted between the T7
promoter and the SIN
poly(dT) sequence to allow more efficient
T7 transcription. The
sequence of the region synthesized by PCR
was confirmed by sequencing.
Several additional plus-sense capped RNA transcripts or RNA substrates
were used to examine template specificity. The predicted
sizes and
3'-terminal sequences or structures of these RNAs are
summarized in
Table
1. Brief descriptions of these RNA
substrates
follow. pTET/HCV5'T7/FL

BglII/poly(A) can be used to
transcribe
an internally deleted (between
BglII sites at
3236 and 8938) hepatitis
C virus (HCV) RNA with a 3'-terminal poly(A)
tract [called HCV

poly(A)].
AseI-digested
pTET/HCV5'T7/FL

BglII/poly(A) was used for in vitro
transcription
with T7 polymerase. pTET/HCV5'T7/FL

BglII/poly(U),
which is similar
to pTET/HCV5'T7/FL

BglII/poly(A), except that
the 3' nontranslated
region (NTR) terminates with a 3' poly(U)
tract, was linearized with
DraI and transcribed with T7 RNA polymerase
[called
HCV

poly(U)]. pYF5'3'IV (
29), which encodes an internally
deleted yellow fever virus RNA, was linearized with
XhoI and
transcribed
with SP6 polymerase. pToto1101, a full-length cDNA clone of
the
SIN genome (
30), was linearized with
XhoI and
transcribed with
SP6 polymerase. pSP6-SF4, a full-length cDNA clone of
Semliki
Forest virus (
21), was linearized with
SpeI and transcribed
with SP6 RNA polymerase. pVR2, a
plasmid encoding a Venezuelan
equine encephalitis replicon
(
3), was linearized with
NotI
and transcribed
with T7 RNA polymerase. pRR64, a full-length cDNA
clone of Ross River
virus (
14), was linearized with
SstI and
transcribed with T7 polymerase. pRobo102, a full-length cDNA clone
of
rubella virus (
38), was digested with
NsiI,
treated with
T4 DNA polymerase to remove a 3' overhanging end, and
transcribed
with SP6 polymerase.
In addition, brome mosaic virus (BMV) genome RNAs, RNA 1, RNA 2, and
RNA 3 (Promega), were tested as substrates, as well as
poly(A) in the
absence or presence of oligo(U). Oligo(U)
15-30 was
prepared as previously described (
28).
Protein analysis.
P15 and S15 material from equal numbers of
cells was separated by SDS-8% polyacrylamide gel electrophoresis
(PAGE), and after electrophoretic transfer, SIN-specific proteins were
detected with rabbit antiserum specific for nsP1 (nsP1-2; 1/3,000
dilution), nsP2 (nsP2-2; 1/10,000 dilution), nsP3 (WU136; 1/2,000
dilution), or nsP4 (nsP4-1; 1/5,000 dilution) and standard Western
blotting conditions (including successive blocking steps with 3% goat
serum and 5% milk).
 |
RESULTS |
Template-dependent initiation of SIN RNA replication in vitro.
Vaccinia virus recombinants were generated to express SIN
polyproteins and nsPs thought to be essential for the
initiation of minus-strand RNA synthesis. The vaccinia virus
recombinant v123C>S expresses a P123 polyprotein
in which the proteolytic activity residing in nsP2 has been abolished
by a Cys-481-to-Ser substitution (36), yet
P123C>S still functions efficiently in minus-strand RNA
synthesis in vivo (18) in the presence of nsP4. To produce
nsP4 in the absence of an active viral protease, vUb-nsP4 (Tyr), a
recombinant expressing a ubiquitin-nsP4 fusion protein, was generated.
Cellular ubiquitin C-terminal hydrolase should cleave immediately after
the C-terminal Gly of ubiquitin (27) and before the first
amino acid of nsP4, thus generating an nsP4 with no additional
N-terminal residues. It has previously been shown that, when expressed
with its authentic N-terminal Tyr residue, nsP4 generated from Ub-nsP4
is capable of functioning in the synthesis of both minus- and
plus-strand RNAs in vivo (18).
To assay for in vitro polymerase activity, the P15 membrane fraction
was isolated from cells coinfected with vTF7-3 and vaccinia
virus
recombinants expressing P123
C>S and Ub-nsP4 (Tyr).
JNTSCATX,
a SIN-specific plus-sense substrate RNA, was used as an
exogenous
template. This substrate RNA contains all of the necessary
cis-acting
elements for the synthesis of minus-strand,
plus-strand, and subgenomic
RNAs, but requires functional SIN
nsPs supplied in
trans for replication
and transcription.
Addition of JNTSCATX RNA to P15 fractions isolated
from cells
expressing both P123
C>S and nsP4 resulted in the
synthesis
of a genome-length RNA product (Fig.
1).
In the absence
of added JNTSCATX RNA or in reaction mixtures containing
P15 extracts
from cells infected only with vTF7-3, no corresponding
product
was observed (data not shown; see below). In addition, RNA
synthesis
was not detected in extracts from cells expressing only
P123
C>S or nsP4 (Fig.
1), indicating a requirement
for both P123 and nsP4.
Synthesis of discrete subgenomic RNAs
was not detected when P15
extracts containing P123
C>S and
nsP4 were used. It is possible
that the level of RNase in the P15
extract prevents detection
of single-stranded subgenomic RNA
(see below). Alternatively,
this may just reflect the phenotype of the
P123
C>S:nsP4 replicase,
since it has been shown in
vivo that a complex consisting of uncleaved
P123 and nsP4 is very
inefficient at transcription of subgenomic
mRNA
(
18).

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 1.
In vitro synthesis of SIN RNA. P15 fractions were
prepared from BHK-21 cells infected with the indicated vaccinia
virus-SIN recombinants and vTF7-3 (lanes 1 to 3). Reaction mixtures
were incubated with JNTSCATX template RNA at 30°C for 60 min under
standard conditions. Denatured products were separated on an agarose
gel and visualized by autoradiography. Lanes 4 and 5 are radiolabeled
RNA transcript markers corresponding to JNTSCATX subgenomic (S)
and genomic (G) RNAs, respectively.
|
|
RNA accumulation.
A time course of RNA accumulation in vitro
was determined by using extracts containing P123C>S and
nsP4. It appears that initiation and elongation by the SIN replicase
are rapid, because full-length RNA products are observed within 3 to 5 min after the addition of exogenous template (Fig.
2A and data not shown). Full-length
products continued to accumulate for approximately 30 min, reaching a
plateau between 30 to 60 min (Fig. 2A and data not shown). This
suggests either that the enzyme complex is not very stable or
that a component of the reaction mixture, possibly the template RNA,
has become limiting. With regard to RNA template stability,
observable loss of single-stranded template RNA and intact rRNAs was
observed after incubation at 30°C (Fig. 2B).

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 2.
Time course of RNA accumulation. P15 fractions were
prepared from BHK-21 cells infected with vTF7-3 and vaccinia
virus recombinants expressing P123C>S and
Ub-nsP4 (Tyr) (nsP4) as indicated above each lane. Reactions with
JNTSCATX template RNA were incubated at 30°C for the indicated times
(in minutes) under standard conditions. Denatured (A) or
nondenatured (B) RNAs were separated on agarose gels and visualized
by autoradiography (A) or by staining with ethidium bromide (B). In
panels A and B, the position of genome-length JNTSCATX RNA is
indicated. In panel B, 28S and 18S rRNAs are indicated.
|
|
Characterization of the products synthesized in vitro.
To characterize the products of the in vitro assay, the
P123C>S plus nsP4 (P123C>S + nsP4) reaction
products were treated with RNase A, an enzyme specific for
single-stranded nucleic acid, and analyzed on either denaturing or
nondenaturing RNA gels. Untreated control samples were
analyzed in parallel. Similar patterns of labeled RNA were observed for
control samples and samples treated with RNase (data not shown).
Under these RNase digestion conditions, single-stranded JNTSCATX
RNA and rRNA were completely degraded. Furthermore, the
predominant RNA species recovered after denaturation of RNase-treated
material comigrated with JNTSCATX RNA. These results indicate that the
stable full-length or near-full-length reaction products were primarily
in the form of double-stranded RNA. Although we did not detect
single-stranded genome-length RNA products, it is possible that the
level of ribonuclease present in the P15 fraction would have precluded
their detection even had they been synthesized.
To determine the polarity of the RNA synthesized in vitro, four
oligonucleotides were annealed to the labelled reaction
products,
and stretches of RNA present in DNA-RNA hybrids were digested
with RNase H. Plus- and minus-sense RNAs transcribed in vitro
from
plasmids pJNTSCATX(+) and pJNTSCATX(

), respectively, were
used
as controls. All oligonucleotides used were found to promote
specific
digestion by RNase H only when the complementary strand
was present
(data not shown). When the reaction product was hybridized
with two
different oligonucleotides complementary to minus-sense
SIN RNA, most
of the genome-length RNA was digested to produce
minus-strand-specific
fragments of the expected sizes (Fig.
3).
Plus-sense RNA species were not detected when the product was
annealed
with two different oligonucleotides complementary to
plus-sense SIN RNA
(data not shown). These results suggest that
the majority of the newly
synthesized product was minus-sense
SIN RNA. Similar results were
obtained by RNase T
1 analysis (data
not shown).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
RNase H analysis of in vitro-synthesized RNA. (A)
Diagram indicating where the minus-strand-specific primers anneal to
the JNTSCATX template and the lengths (in bases) of the fragments
expected after complete digestion with RNase H. (B) P15 fractions were
prepared from BHK-21 cells infected with vaccinia virus recombinants
expressing P123C>S, Ub-nsP4 (Tyr), and vTF7-3. Reaction
mixtures were incubated with JNTSCATX template RNA under standard
conditions, and the products were denatured, annealed to specific
primers, and digested with RNase H (+) or incubated without added
enzyme ( ). The resulting fragments were separated on a 3.5%
polyacrylamide-urea gel and visualized by autoradiography. As a
control, a minus-sense transcript from pJNTSCATX( ) was analyzed in
parallel. To the right, the positions of various radiolabeled RNA size
markers are indicated (bases).
|
|
Specificity of the SIN replicase.
The template specificity of
the in vitro replicase was examined with a number of substrate RNAs.
Since it is likely that the 3' end of the template RNA plays a role in
minus-strand initiation, substrates with various 3' termini were tested
as templates. The 3'-terminal sequence or structure of each substrate
and the results are summarized in Table 1. Transcripts generated from
pJNTSCATX(+), which are SIN-specific plus-sense RNAs that terminate
with an authentic poly(A) tract, functioned as a template for the SIN replicase. In contrast, RNA synthesis was not observed when a minus-sense transcript from pJNTSCATX(
) was used as a template. This
may indicate that the SIN replicase cannot initiate replication on a
minus-sense RNA, or it may just reflect the phenotype of the
P123C>S:nsP4 replicase, since it has been shown in
vivo that this complex is very inefficient at plus-strand synthesis (18). Because the SIN genome contains a 3' poly(A) tract,
poly(A), in the presence or absence of oligo(U), was tested in the in
vitro reaction. If poly(A) was active as a template, reaction products should be heterogeneous, producing a smear of species when analyzed by
gel electrophoresis. No such smear was observed with these templates,
although interpretation of this experiment is difficult, since various
levels of smaller labeled products are often seen in the in vitro
reactions (independent of SIN-specific replicase components).
HCV RNA transcripts (3.7 kb) terminating with either poly(A) or
poly(U) were also unable to direct the synthesis of genome-length RNA
products. To examine whether the SIN replicase could utilize 3'
secondary structures to initiate RNA synthesis, a transcript containing
a predicted 3'-terminal hairpin was generated from a deleted form of
the yellow fever virus genome (YF5'3'IV). When tested in the in vitro
reaction, RNA synthesis was not detected with this template. Likewise,
synthesis of discrete products was not observed with BMV RNAs 1, 2, and
3, which contain 3' tRNA-like structures.
Besides the JNTSCATX RNA substrate, we also examined the activity of
the P123
C>S + nsP4 P15 replicase on longer RNAs,
including
full-length SIN RNA and heterologous RNAs of other
members of
the
Alphavirus genus. Addition of full-length SIN
RNA yielded
efficient synthesis of an 11.7-kb RNA product (Fig.
4, lane 1).
For Semliki Forest virus and
Ross River virus, some full-length
RNA products were also
observed, but most appeared to be incompletely
transcribed or
partially degraded (Fig.
4, lanes 2 and 4). Neither
Venezuelan equine
encephalitis virus replicon RNA lacking the
structural region (~7 kb;
Fig.
4, lane 4) nor rubella virus RNA
(Fig.
4, lane 6), which lacks the
conserved 3'-terminal RNA element
thought to be important in initiation
of alphavirus minus-strand
RNA synthesis (
37), was
efficiently utilized by this SIN replicase
preparation.

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 4.
In vitro replication of full-length SIN RNA and
heterologous Togaviridae templates by the SIN replicase. In
vitro transcripts from the full-length or subgenomic replicon
cDNAs were used as templates in P15 extracts containing
P123C>S and Ub-nsP4 (Tyr). Reaction mixtures were
incubated at 30°C for 60 min under standard conditions. The products
were denatured, separated on an agarose gel, and visualized by
autoradiography. , no added template RNA; SFV, Semliki Forest virus;
VEE rep, Venezuelan equine encephalitis virus subgenomic RNA
replicon; RRV, Ross River virus; RUB, rubella virus. The positions of
genome-length SIN RNA (11.7 kb) and 28S and 18S rRNAs are indicated to
the right.
|
|
Authentic SIN genome RNA terminates with poly(A). To examine the
importance of the SIN 3' end for template activity in the
in
vitro assay, pJNTSCATX(+) was linearized with different restriction
enzymes, and these templates were used to produce RNAs with different
3' termini (Fig.
5A). RNA synthesized
from
BsgI-linearized pJNTSCATX(+)
should terminate
with poly(A) and was efficiently utilized by
the in vitro SIN replicase
(Fig.
5B, lane 3). No effect, and perhaps
even enhanced activity, was
observed when a short (32-base) sequence
was added 3' to the
poly(A) (Fig.
5B, lane 4). Longer 3' (184-
or 859-base) extensions of
nonviral sequences past the poly(A)
reduced RNA synthesis significantly
(Fig.
5B, lanes 5 and 6).
As expected from previous work (
11,
13), transcripts terminating
in the SIN 3' noncoding region
upstream of the 3'-terminal 19-base
conserved sequence and poly(A)
tract were no longer substrates
for the replicase (Fig.
5B, lane 2).
Since the mobilities of the
predominant products appear to be identical
and correspond in
size to the RNA produced from the
BsgI-linearized template (Fig.
5B, lanes 3 to 6), it is
likely that initiation of viral RNA synthesis
occurred
at or near the poly(A) in all templates. For the RNA
substrates
with detectably longer 3' extensions, this suggests
that
minus-strand initiation can occur at an internal site on
the template.
Alternatively, plus-strand templates resulting from
premature
termination in the poly(A) during SP6 transcription
or from partial
degradation in the in vitro assay may be preferentially
utilized for
minus-strand initiation.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
In vitro replication of SIN RNA templates with different
3' termini. (A) Diagram representing the JNTSCATX(+) cDNA with the
positions of the various runoff sites indicated. Shown below are the
predicted RNA substrates generated after transcription. Letters to the
left are abbreviations of the restriction enzymes used to linearize
pJNTSCATX(+); F, FspI; Bs, BsgI; X,
XhoI; E, EarI; Bg, BglI. The
numbers to the right indicate the transcript length (in bases). (B) As
diagrammed in panel A, plus-sense SIN RNAs with different 3'
termini were tested in the in vitro replication assay. After
pJNTSCATX(+) was linearized with various restriction enzymes,
3'-protruding ends were removed with Klenow enzyme, and RNA templates
were synthesized with SP6 polymerase. In vitro replication assays were
performed with P15 extracts containing P123C>S and Ub-nsP4
(Tyr) under standard conditions, and the products were analyzed by gel
electrophoresis. The size of genome-length RNA produced from
pJNTSCATX(+) linearized with BsgI is indicated by the bar to
the right.
|
|
Test of the regulatory model by using the in vitro assay.
As
described previously (18, 35, 37), our current model of SIN
RNA replication is that uncleaved P123 or the P23 cleavage intermediate
is required for the initiation of minus-strand synthesis. Processing at
the 1/2 and 2/3 sites causes a conformational change, resulting in
replication complexes inefficient at initiating minus-strand synthesis.
To examine the requirement for polyproteins in minus-strand synthesis, extracts from cells infected with vaccinia virus
recombinants expressing nsP4 and various P123 derivatives were tested
for their ability to synthesize RNA in vitro. One extract contained
P123, a P123 polyprotein that has an active nsP2 protease and
is capable of being processed. A second extract contained
P123N>D, a P123 polyprotein which contains an
Asn-614-to-Asp substitution in nsP2 that enhances the efficiency of in
vitro proteolytic processing such that uncleaved P123 cannot be
detected (36). A third extract contained
P12*3N>D, a polyprotein that contains the nsP2
hyperprocessing mutation but that cannot be processed at the 2/3
cleavage site because of a single amino acid substitution that blocks
cleavage at this site (the asterisk indicates a cleavage site that
cannot be processed). As shown in Fig.
6A, extracts containing nsP4 and uncleaved P123C>S exhibited efficient replicase activity
upon addition of exogenous template, whereas RNA synthesis was greatly decreased in extracts containing cleavage-competent P123 and nsP4. RNA
synthesis was barely detectable in extracts from cells infected with
recombinants expressing nsP4 and P123N>D, the
hyperprocessing mutant. However, in extracts containing
P12*3N>D, in which the hyperprocessing mutation was
present in a polyprotein that could not be cleaved at the 2/3
site, replicase activity was restored. This suggests that the
inefficient RNA synthesis with P123N>D was not a result of
the Asn-614-to-Asp substitution, but rather resulted from the lack of
any uncleaved P123 or P23 polyprotein.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Comparison of the in vitro activities of replication
complexes containing cleaved and uncleaved SIN nonstructural
components. (A) P15 fractions were prepared from BHK-21 cells infected
with vTF7-3, vUb-nsP4 (Tyr), and vaccinia virus-SIN recombinants
expressing the indicated SIN polyproteins. In vitro assays were
performed with SIN-specific JNTSCATX RNA substrate (+) or a
heterologous HCV poly(A) RNA substrate ( ) under standard
conditions. Denatured products were separated on an agarose gel and
visualized by autoradiography. (B) SIN-specific proteins in the P15
fraction were separated on an SDS-8% polyacrylamide gel and detected
by Western blotting with antisera ( ) specific for nsP1, nsP2, nsP3,
or nsP4. A lysate from mock-infected cells (mock) which had only been
infected with vTF7-3 was included as a control. The positions of the
SIN polyproteins and nsPs are indicated. Note that SIN nsP3
migrates as multiple species because of differential phosphorylation
(19). (C) Experimental procedures were as described for
panel A. In panels A and C, the bar on the left indicates the position
of genome-length JNTSCATX RNA.
|
|
The SIN-specific proteins in the P15 extracts were examined by
Western blot analysis with antibodies specific for nsP1, nsP2,
nsP3, and nsP4. As expected for the P123
C>S + nsP4
replicase
preparation, high levels of the P123
C>S
polyprotein were present,
and processing at the 1/2 and 2/3
sites was not observed (Fig.
6B). During
expression of P123 and P123
N>D, cleavage products
nsP1,
nsP2, and nsP3 were produced, but polyproteins P123, P12,
and
P23 were not detected. For P12*3
N>D, efficient
processing
at the 1/2 site resulted in the production of P2*3 and
nsP1, but
the P12*3 polyprotein could not be detected.
Recent studies have also shown that a complex consisting of nsP1,
P23
C>S, and nsP4 can function in RNA replication in vivo
(
15). This complex efficiently synthesizes minus-strand and
plus-strand genomic RNAs, but is inefficient at transcription
of subgenomic mRNA. To examine whether this complex could
function
in the in vitro assay, the vaccinia virus recombinant
vUb-P23
C>S was utilized. This recombinant expresses a P23
polyprotein that
contains no additional N-terminal residues and
is not processed
because of an inactive nsP2 protease (
15).
Upon addition of
template RNA, P15 extracts containing nsP1,
P23
C>S, and nsP4
synthesized genome-length RNA products at
levels somewhat lower
than that observed with P123
C>S and
nsP4, and synthesis of
subgenomic RNA was not detected (Fig.
6C). In contrast, very little,
if any, RNA synthesis was observed with
extracts containing nsP1,
nsP4, and a cleavage-competent P23 (Fig.
6C).
Western blot analysis
was performed with these extracts with antibodies
monospecific
for nsP1 and nsP2. As expected, the P123
C>S + nsP4 and the
nsP1 + P23
C>S + nsP4 extracts contained
uncleaved P123 and
P23, respectively. Extracts from cells infected with
vaccinia
virus recombinants expressing P123 + nsP4 or nsP1 + P23 + nsP4
contained predominantly nsP1 and nsP2, with very little
uncleaved
P123 or P23 precursor present (data not shown). These results
are consistent with previous in vivo observations suggesting that
initiation of minus-strand RNA synthesis requires a complex containing
uncleaved P123 or P23 (
15,
18).
Soluble polymerase activity.
Although alphavirus replication
complexes are membrane associated, a solubilized complex capable of
elongating SIN RNAs has been isolated from SIN-infected cells
(2). However, we were unable to solubilize the in vitro
minus-strand initiation complex by using deoxycholate or Triton X-100
(data not shown). As another approach to obtaining a soluble replicase,
we examined whether the SIN-specific proteins in the S15 fraction,
rather than the P15 fraction, could function in RNA replication. Upon
addition of exogenous template, polymerase activity could not be
detected in S15 fractions from cells infected with vaccinia virus
recombinants expressing P123C>S and nsP4, even when mixed
with a P15 fraction from mock-infected cells (data not shown). Protein
analysis of these fractions revealed that when coexpressed, only low
levels of P123C>S and nsP4 were present in the S15
fraction (Fig. 7), which could account
for the lack of replicase activity. Additional mixing experiments were
performed to determine whether SIN proteins in the S15 fraction could
complement a P15 fraction lacking one of the replicase components
essential for initiation of RNA synthesis. Addition of S15 extract
containing P123C>S to a P15 fraction from cells expressing
nsP4 resulted in no detectable RNA synthesis (data not shown); however,
very little P123C>S was present in the S15 fraction (Fig.
7). In contrast, high levels of nsP4 are found in the S15 fraction when
nsP4 is expressed in the absence of other SIN nsPs (Fig. 7). Addition
of S15 extract containing nsP4 to a P15 fraction from cells expressing
P123C>S resulted in a functional replicase that
synthesized genome-length RNA (Fig. 8).
This result shows that an active minus-strand initiation complex can be
formed by adding soluble polymerase to the P123C>S P15 fraction and provides an assay for purification of the SIN nsP4 polymerase.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
Distribution of SIN nsPs in P15 and S15 fractions. P15
and S15 fractions were prepared from BHK-21 cells infected with the
indicated vaccinia virus-SIN recombinants and vTF7-3. Material from
equal numbers of cells was separated by SDS-PAGE on 8% polyacrylamide
gels, and SIN-specific proteins were detected by Western blotting and
probing with antiserum specific for nsP2 or nsP4. A lysate from cells
which had only been infected with vTF7-3 (mock) was included as a
control. The levels of SIN-specific protein were quantified with a
Betagen Betascope, and the percentage of a particular SIN nsP present
in the P15 and S15 fractions is indicated at the bottom.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 8.
Extracts containing soluble nsP4 allow initiation of SIN
RNA replication in vitro. P15 fractions were prepared from BHK-21 cells
infected with vaccinia virus-SIN recombinant v123C>S and
vTF7-3 (lanes 2 to 5). The S15 fraction was prepared from cells
coinfected with vTF7-3 and vUb-nsP4 (Tyr) or from cells infected with
vTF7-3 alone (mock). In vitro reaction mixtures containing the P15
fraction and increasing amounts of nsP4-containing (5, 10, and 18 µl
in lanes 2, 3, and 4, respectively) or mock (18 µl in lane 5) S15
fraction were incubated under standard conditions with JNTSCATX
template RNA, and the denatured products were separated on an agarose
gel. A P15 fraction from cells coinfected with vTF7-3,
v123C>S, and vUb-nsP4 (Tyr) was assayed in parallel as a
positive control (lane 1).
|
|
 |
DISCUSSION |
In this paper, we report the first isolation of an alphavirus
replicase capable of initiating RNA synthesis in vitro. Replicase activity was dependent on the addition of exogenous template, required
both P123 and nsP4 (or nsP1, P23, and nsP4), and was specific for SIN
plus-strand RNA templates. Elements key to the development of this
template-dependent assay were (i) the utilization of a heterologous
system for expression of functional SIN polyproteins and nsPs
and (ii) the observation that uncleaved polyprotein P123 or P23
and mature nsP4 were necessary for efficient minus-strand initiation.
Based on previous studies with a vaccinia virus transient expression
system, along with other in vivo studies (31, 35), a model
for the composition of SIN replicase complexes and the temporal
regulation of SIN minus- and plus-strand RNAs has been proposed
(18, 35). This model predicts that uncleaved P123 or the P23
cleavage intermediate and nsP4 are required for initiation of
minus-strand synthesis. This complex is also capable of plus-strand synthesis, although initiation of genomic and
subgenomic synthesis is inefficient. Processing at the 1/2 and
2/3 sites converts the complex into a replicase containing nsP1, nsP2,
nsP3, and nsP4, causing a conformational change that switches the
template preference of this complex from plus to minus strands, leading
to more efficient plus-strand synthesis. Cleavage at the 1/2 and 2/3
sites inactivates the ability of the complex to function
efficiently in minus-strand initiation and results in the
shutoff of minus-strand synthesis. These recent insights into the early
events in SIN RNA replication could explain the difficulty that we, and
others, have had in developing an in vitro assay for initiation of SIN
RNA synthesis, since these attempts have most likely used extracts from
SIN-infected cells which contain an active protease. The vaccinia virus
system provided a means of expressing the required polyprotein
intermediates, by using mutations which inactivate the SIN nsP2
protease, while still allowing expression of the nsP4 polymerase. In
addition, this system allows one to express the replicase components in the absence of a replication-competent SIN RNA, eliminating the need to
remove any endogenous RNA which might prevent the replicase from
accepting an exogenous template.
A number of RNA template-dependent polymerase preparations have been
isolated from cells infected with eukaryotic positive-strand RNA
viruses; however, very few systems have been able to carry out complete
RNA replication (10, 40). The reaction product in the SIN in
vitro system consisted primarily of genome-length minus-strand RNA.
Even when the template RNA was introduced in the presence of Lipofectin
(Gibco-BRL), which has been shown to allow plus-strand RNA synthesis to
occur for flock house virus (41), there was no significant
increase in the amount of minus-strand RNA produced, nor was there a
stimulation of plus-strand synthesis (data not shown). The inability of
the P123C>S:nsP4 replicase to catalyze complete
replication of RNA could result because the preparation lacks a
cofactor necessary for plus-strand synthesis. It has recently been
demonstrated that the La protein in mosquito cells and chicken cells
binds to the 3' end of SIN minus-strand RNA with high affinity
(24, 25), and it has been postulated that this protein may
be involved in the initiation of plus-strand RNA synthesis.
Alternatively, inefficient plus-strand RNA synthesis in vitro would
mimic the in vivo phenotype of this replicase (18) and may
simply reflect the nature of a replication complex consisting of
uncleaved P123 and nsP4. Processing of this complex in vitro may be
necessary to convert it to a plus-strand replicase which is active
enough to allow detection of plus-strand genomic and subgenomic RNA synthesis. It will be of interest to examine the polarity of RNA products synthesized with the nsP1 + P23 + nsP4 replicase, since this complex can synthesize plus-strand RNA in vivo (15).
The SIN replicase exhibited specificity in that it did not utilize a
number of RNA templates tested as substrates. The highest efficiency
was observed for the SIN genome RNA, but the SIN replicase could also
utilize Semliki Forest virus and Ross River virus RNAs. This is likely
due to the conserved sequence elements that are found at the 5' and 3'
ends of all alphavirus genomes that are believed to function as
cis elements for initiation of RNA synthesis. It has been
postulated that the 19-base element adjacent to the poly(A) tail and
sequences in the 5' NTR or nsP coding region, in particular the
51-nucleotide element near the 5' end, may play a role in minus-strand
initiation (37). Analyses of artificial 5' or 3' NTR
chimeras between SIN and Ross River virus have demonstrated that Ross
River virus 3' NTR elements can be readily utilized by the SIN
replicase in vivo, but that the 5' NTR is less interchangeable (14). The ability of the SIN replicase to utilize,
albeit less efficiently, heterologous alphavirus templates in
vitro is consistent with these in vivo data. In addition, the deletion
which eliminated the 19-base element and poly(A) abolished the
ability of the SIN template RNA to function in the in vitro assay,
which also fits with in vivo genetic analyses of the 3' NTR (11,
13).
To test the requirement for P123 or P23 in minus-strand initiation, we
compared the abilities of P15 fractions containing nsP4 and either
uncleaved polyproteins or cleavage-competent proteins to
function in RNA synthesis. RNA synthesis was observed in extracts from
cells infected with recombinants expressing a cleavage-competent polyprotein, although at very low levels. It is possible that this activity results from uncleaved polypeptide present in these extracts in amounts that are below the level of detection.
Alternatively, the cleavage products may be able to form a replicase
that functions inefficiently in minus-strand RNA synthesis under these
conditions. The level of RNA synthesis was even lower, however, in the
P123N>D extract than in extracts in which P123 was
expressed. The Asn-614-to-Asp mutation could be suppressed by inclusion
of a mutation blocking processing at the 2/3 site
(P12*3N>D), suggesting the reduced activity observed for
P123N>D was due to the hyperprocessing phenotype conferred
by this mutation, rather than some other effect of the substitution on
replicase efficiency. Unprocessed P23 (P23C>S) was also
shown to function more efficiently than cleavage-competent P23 as a
minus-strand replicase component. Consistent with the model based on in
vivo data, these in vitro results suggest that an uncleaved
polypeptide is required for efficient initiation of SIN RNA
synthesis and that processing at the 2/3 site is the critical
cleavage inactivating the minus-strand initiation complex.
Although the minus-strand initiation complex could not be solubilized
by detergent treatment, soluble nsP4, which could form an active
minus-strand initiation-elongation complex when added to a P15 extract
containing P123C>S, was obtained from the S15 fraction.
This provides a useful assay for purification and characterization of
the nsP4 RNA-dependent RNA polymerase. The inability to obtain a
functional replicase with other P15-S15 combinations may be due to the
low concentration of nsPs in certain fractions or may reflect a
requirement for membrane association of specific nsPs. A possible
candidate for this might be nsP1, since it has recently been shown to
be membrane associated (26). Alternatively, given the
complex regulatory scheme SIN uses for production of its nsPs, the
timing of the appearance of the various nsPs may be crucial for
promoting specific interactions necessary for active complex formation.
The template-dependent initiation-elongation assay
presented in this paper provides a system with which to study the
mechanisms involved in the initiation of SIN RNA replication and a
means of analyzing the roles of the virus- and host-encoded
subunits in RNA replication and transcription. In particular, this
system should be useful for examining the processes involved in
conversion of a SIN minus-strand replicase to one which efficiently
synthesizes plus-strand RNAs and allow the identification of the
components and RNA-protein interactions involved in minus-strand
initiation.
 |
ACKNOWLEDGMENTS |
We thank the following colleagues for providing materials:
Teryl K. Frey (pRobo102), Robert E. Johnston (pVR2), Richard
J. Kuhn (pRR64), Peter Liljeström (pSP6-SF4), and Bernard Moss
(vTF7-3 and pTM3). We are also grateful to many colleagues for helpful discussions during the course of this work
in particular,
Dorothea Sawicki
and Ilya Frolov, Mara Lippa, Tina Myers, and
Karen Reed for critical reading of the manuscript.
This work was supported by a grant from the Public Health Service
(AI24134). A.B. was supported by fellowships from the Swedish Institute, the Swedish Medical Research Council, and the Wenner-Gren Center Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Microbiology, Washington University School of Medicine, 660 South Euclid Ave., St. Louis, MO 63110-1093. Phone: (314) 362-2842. Fax: (314) 362-1232. E-mail: rice{at}borcim.wustl.edu.
Present address: Department of Virology, Bristol-Myers Squibb
Pharmaceutical Research Institute, Wallingford, CT 06492.
Present address: Department of Medical Immunology and
Microbiology, Uppsala University, Biomedical Centre, S-751 23 Uppsala, Sweden.
 |
REFERENCES |
| 1.
|
Barton, D. J.,
S. G. Sawicki, and D. L. Sawicki.
1988.
Demonstration in vitro of temperature-sensitive elongation of RNA in Sindbis virus mutant ts6.
J. Virol.
62:3597-3602[Abstract/Free Full Text].
|
| 2.
|
Barton, D. J.,
S. G. Sawicki, and D. L. Sawicki.
1991.
Solubilization and immunoprecipitation of alphavirus replication complexes.
J. Virol.
65:1496-1506[Abstract/Free Full Text].
|
| 3.
|
Davis, N. L.,
K. W. Brown, and R. E. Johnston.
1996.
A viral vaccine vector that expresses foreign genes in lymph nodes and protects against mucosal challenge.
J. Virol.
70:3781-3787[Abstract].
|
| 4.
|
deGroot, R. J.,
W. R. Hardy,
Y. Shirako, and J. H. Strauss.
1990.
Cleavage-site preferences of Sindbis virus polyproteins containing the nonstructural proteinase: evidence for temporal regulation of polyprotein processing in vivo.
EMBO J.
9:2631-2638[Medline].
|
| 5.
|
Ding, M., and M. J. Schlesinger.
1989.
Evidence that Sindbis virus nsP2 is an autoprotease which processes the virus nonstructural polyprotein.
Virology
171:280-284[Medline].
|
| 6.
|
Falkner, F. G., and B. Moss.
1988.
Escherichia coli gpt gene provides dominant selection for vaccinia virus open reading frame expression vectors.
J. Virol.
62:1849-1854[Abstract/Free Full Text].
|
| 7.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 8.
|
Hardy, W. R., and J. H. Strauss.
1988.
Processing the nonstructural polyproteins of Sindbis virus: study of the kinetics in vivo by using monospecific antibodies.
J. Virol.
62:998-1007[Abstract/Free Full Text].
|
| 9.
|
Hardy, W. R., and J. H. Strauss.
1989.
Processing the nonstructural proteins of Sindbis virus: nonstructural proteinase is in the C-terminal half of nsP2 and functions both in cis and in trans.
J. Virol.
63:4653-4664[Abstract/Free Full Text].
|
| 10.
|
Hayes, R. J., and K. W. Buck.
1990.
Complete replication of a eukaryotic virus RNA in vitro by a purified RNA-dependent RNA polymerase.
Cell
63:363-368[Medline].
|
| 11.
|
Hill, K. R.,
M. Hajjou,
J. Y. Hu, and R. Raju.
1997.
RNA-RNA recombination in Sindbis virus: roles of the 3' conserved motif, poly(A) tail, and nonviral sequences of template RNAs in polymerase recognition and template switching.
J. Virol.
71:2693-2704[Abstract].
|
| 12.
|
Hruby, D. E.,
L. A. Guarino, and J. R. Kates.
1979.
Vaccinia virus replication. I. Requirement for the host-cell nucleus.
J. Virol.
29:705-715[Abstract/Free Full Text].
|
| 13.
|
Kuhn, R. J.,
Z. Hong, and J. H. Strauss.
1990.
Mutagenesis of the 3' nontranslated region of Sindbis virus RNA.
J. Virol.
64:1465-1476[Abstract/Free Full Text].
|
| 14.
|
Kuhn, R. J.,
H. G. M. Niesters,
Z. Hong, and J. H. Strauss.
1991.
Infectious RNA transcripts from Ross River virus cDNA clones and the construction and characterization of defined chimeras with Sindbis virus.
Virology
182:430-441[Medline].
|
| 15.
| Lemm, J. A., and C. M. Rice. Unpublished
data.
|
| 16.
|
Lemm, J. A., and C. M. Rice.
1993.
Assembly of functional Sindbis virus RNA replication complexes: requirement for coexpression of P123 and P34.
J. Virol.
67:1905-1915[Abstract/Free Full Text].
|
| 17.
|
Lemm, J. A., and C. M. Rice.
1993.
Roles of nonstructural polyproteins and cleavage products in regulating Sindbis virus RNA replication and transcription.
J. Virol.
67:1916-1926[Abstract/Free Full Text].
|
| 18.
|
Lemm, J. A.,
T. Rümenapf,
E. G. Strauss,
J. H. Strauss, and C. M. Rice.
1994.
Polypeptide requirements for assembly of functional Sindbis virus replication complexes: a model for the temporal regulation of minus and plus-strand RNA synthesis.
EMBO J.
13:2925-2934[Medline].
|
| 19.
|
Li, G.,
M. W. LaStarza,
W. R. Hardy,
J. H. Strauss, and C. M. Rice.
1990.
Phosphorylation of Sindbis virus nsP3 in vivo and in vitro.
Virology
179:416-427[Medline].
|
| 20.
|
Li, G.,
B. Prágai, and C. M. Rice.
1991.
Rescue of Sindbis virus-specific RNA replication and transcription by using a vaccinia virus recombinant.
J. Virol.
65:6714-6723[Abstract/Free Full Text].
|
| 21.
|
Liljeström, P.,
S. Lusa,
D. Huylebroeck, and H. Garoff.
1991.
In vitro mutagenesis of a full-length cDNA clone of Semliki Forest virus: the small 6,000-molecular-weight membrane protein modulates virus release.
J. Virol.
65:4107-4113[Abstract/Free Full Text].
|
| 22.
|
Mackett, M., and G. L. Smith.
1986.
Vaccinia virus expression vectors.
J. Gen. Virol.
67:2067-2082[Abstract/Free Full Text].
|
| 23.
|
Melton, D. A.,
P. A. Krieg,
M. R. Rebagliati,
T. Maniatis,
K. Zinn, and M. R. Green.
1984.
Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucleic Acids Res.
12:7035-7056[Abstract/Free Full Text].
|
| 24.
|
Pardigon, N., and J. H. Strauss.
1992.
Cellular proteins bind to the 3' end of Sindbis virus minus-strand RNA.
J. Virol.
66:1007-1015[Abstract/Free Full Text].
|
| 25.
|
Pardigon, N., and J. H. Strauss.
1996.
Mosquito homolog of the La autoantigen binds to Sindbis virus RNA.
J. Virol.
70:1173-1181[Abstract].
|
| 26.
|
Peränen, J.,
P. Laakkonen,
M. Hyvonen, and L. Kääriänen.
1995.
The alphavirus replicase protein nsP1 is membrane-associated and has affinity to endocytic organelles.
Virology
208:610-620[Medline].
|
| 27.
|
Pickart, C. M., and I. A. Rose.
1985.
Ubiquitin carboxyl-terminal hydrolase acts on ubiquitin carboxyl-terminal amides.
J. Biol. Chem.
260:7903-7910[Abstract/Free Full Text].
|
| 28.
|
Plotch, S. J.,
O. Palant, and Y. Gluzman.
1989.
Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli.
J. Virol.
63:216-225[Abstract/Free Full Text].
|
| 29.
|
Rice, C. M.,
A. Grakoui,
R. Galler, and T. J. Chambers.
1989.
Transcription of infectious yellow fever virus RNA from full-length cDNA templates produced by in vitro ligation.
New Biol.
1:285-296[Medline].
|
| 30.
|
Rice, C. M.,
R. Levis,
J. H. Strauss, and H. V. Huang.
1987.
Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker, and in vitro mutagenesis to generate defined mutants.
J. Virol.
61:3809-3819[Abstract/Free Full Text].
|
| 31.
|
Sawicki, D. L., and S. G. Sawicki.
1993.
A second nonstructural protein functions in the regulation of alphavirus negative-strand RNA synthesis.
J. Virol.
67:3605-3610[Abstract/Free Full Text].
|
| 32.
|
Sawicki, D. L.,
S. G. Sawicki,
S. Keränen, and L. Kääriäinen.
1981.
Specific Sindbis virus-coded function for minus-strand RNA synthesis.
J. Virol.
39:348-358[Abstract/Free Full Text].
|
| 33.
|
Sawicki, S. G.,
D. L. Sawicki,
L. Kääriäinen, and S. Keränen.
1981.
A Sindbis virus mutant temperature-sensitive in the regulation of minus-strand RNA synthesis.
Virology
115:161-172[Medline].
|
| 34.
|
Shirako, Y., and J. H. Strauss.
1990.
Cleavage between nsP1 and nsP2 initiates the processing pathway of Sindbis virus nonstructural polyprotein P123.
Virology
177:54-64[Medline].
|
| 35.
|
Shirako, Y., and J. H. Strauss.
1994.
Regulation of Sindbis virus RNA replication: uncleaved P123 and nsP4 function in minus-strand RNA synthesis, whereas cleaved products from P123 are required for efficient plus-strand RNA synthesis.
J. Virol.
68:1874-1885[Abstract/Free Full Text].
|
| 36.
|
Strauss, E. G.,
R. J. deGroot,
R. Levinson, and J. H. Strauss.
1992.
Identification of the active site residues in the nsP2 proteinase of Sindbis virus.
Virology
191:932-940[Medline].
|
| 37.
|
Strauss, J. H., and E. G. Strauss.
1994.
The alphaviruses: gene expression, replication, and evolution.
Microbiol. Rev.
58:491-562[Abstract/Free Full Text].
|
| 38.
|
Wang, C.-Y.,
G. Dominguez, and T. K. Frey.
1994.
Construction of rubella virus genome-length cDNA clones and synthesis of infectious RNA transcripts.
J. Virol.
68:3550-3557[Abstract/Free Full Text].
|
| 39.
|
Wengler, G.,
G. Wengler, and H. S. Gross.
1979.
Replicative form of Semliki Forest virus RNA contains an unpaired guanosine.
Nature
282:754-756[Medline].
|
| 40.
|
Wu, S.-X.,
P. Ahlquist, and P. Kaesberg.
1992.
Active complete in vitro replication of nodavirus RNA requires glycerophospholipid.
Proc. Natl. Acad. Sci. USA
89:11136-11140[Abstract/Free Full Text].
|
| 41.
|
Wu, S.-X., and P. Kaesberg.
1991.
Synthesis of template-sense, single-stranded Flockhouse virus RNA in a cell-free replication system.
Virology
183:392-396[Medline].
|
J Virol, August 1998, p. 6546-6553, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Mayuri, , Geders, T. W., Smith, J. L., Kuhn, R. J.
(2008). Role for Conserved Residues of Sindbis Virus Nonstructural Protein 2 Methyltransferase-Like Domain in Regulation of Minus-Strand Synthesis and Development of Cytopathic Infection. J. Virol.
82: 7284-7297
[Abstract]
[Full Text]
-
Li, M.-L., Kwan, T.-Y., Simmonds, H. A., Stollar, V.
(2008). Synthesis of Genomic and Subgenomic RNA in Mosquito Cells Infected with Two Sindbis Virus nsP4 Mutants: Influence of Intracellular Nucleoside Triphosphate Concentrations. J. Virol.
82: 6880-6888
[Abstract]
[Full Text]
-
Montgomery, S. A., Johnston, R. E.
(2007). Nuclear Import and Export of Venezuelan Equine Encephalitis Virus Nonstructural Protein 2. J. Virol.
81: 10268-10279
[Abstract]
[Full Text]
-
Li, M.-L., Stollar, V.
(2007). Distinct Sites on the Sindbis Virus RNA-Dependent RNA Polymerase for Binding to the Promoters for the Synthesis of Genomic and Subgenomic RNA. J. Virol.
81: 4371-4373
[Abstract]
[Full Text]
-
Montgomery, S. A., Berglund, P., Beard, C. W., Johnston, R. E.
(2006). Ribosomal protein s6 associates with alphavirus nonstructural protein 2 and mediates expression from alphavirus messages.. J. Virol.
80: 7729-7739
[Abstract]
[Full Text]
-
Lulla, A., Lulla, V., Tints, K., Ahola, T., Merits, A.
(2006). Molecular determinants of substrate specificity for semliki forest virus nonstructural protease.. J. Virol.
80: 5413-5422
[Abstract]
[Full Text]
-
Galbraith, S. E., Sheahan, B. J., Atkins, G. J.
(2006). Deletions in the hypervariable domain of the nsP3 gene attenuate Semliki Forest virus virulence.. J. Gen. Virol.
87: 937-947
[Abstract]
[Full Text]
-
Frolova, E., Gorchakov, R., Garmashova, N., Atasheva, S., Vergara, L. A., Frolov, I.
(2006). Formation of nsP3-Specific Protein Complexes during Sindbis Virus Replication.. J. Virol.
80: 4122-4134
[Abstract]
[Full Text]
-
Sawicki, D. L., Perri, S., Polo, J. M., Sawicki, S. G.
(2006). Role for nsP2 Proteins in the Cessation of Alphavirus Minus-Strand Synthesis by Host Cells. J. Virol.
80: 360-371
[Abstract]
[Full Text]
-
Hardy, R. W., Rice, C. M.
(2005). Requirements at the 3' End of the Sindbis Virus Genome for Efficient Synthesis of Minus-Strand RNA. J. Virol.
79: 4630-4639
[Abstract]
[Full Text]
-
Li, M.-L., Lin, Y.-H., Simmonds, H. A., Stollar, V.
(2004). A Mutant of Sindbis Virus Which Is Able To Replicate in Cells with Reduced CTP Makes a Replicase/Transcriptase with a Decreased Km for CTP. J. Virol.
78: 9645-9651
[Abstract]
[Full Text]
-
Li, M.-L., Stollar, V.
(2004). Identification of the amino acid sequence in Sindbis virus nsP4 that binds to the promoter for the synthesis of the subgenomic RNA. Proc. Natl. Acad. Sci. USA
101: 9429-9434
[Abstract]
[Full Text]
-
Wang, H.-H., Wong, S.-M.
(2004). Significance of the 3'-terminal region in minus-strand RNA synthesis of Hibiscus chlorotic ringspot virus. J. Gen. Virol.
85: 1763-1776
[Abstract]
[Full Text]
-
De, I., Fata-Hartley, C., Sawicki, S. G., Sawicki, D. L.
(2003). Functional Analysis of nsP3 Phosphoprotein Mutants of Sindbis Virus. J. Virol.
77: 13106-13116
[Abstract]
[Full Text]
-
Vasiljeva, L., Merits, A., Golubtsov, A., Sizemskaja, V., Kaariainen, L., Ahola, T.
(2003). Regulation of the Sequential Processing of Semliki Forest Virus Replicase Polyprotein. J. Biol. Chem.
278: 41636-41645
[Abstract]
[Full Text]
-
Salonen, A., Vasiljeva, L., Merits, A., Magden, J., Jokitalo, E., Kaariainen, L.
(2003). Properly Folded Nonstructural Polyprotein Directs the Semliki Forest Virus Replication Complex to the Endosomal Compartment. J. Virol.
77: 1691-1702
[Abstract]
[Full Text]
-
Hardy, R. W., Marcotrigiano, J., Blight, K. J., Majors, J. E., Rice, C. M.
(2003). Hepatitis C Virus RNA Synthesis in a Cell-Free System Isolated from Replicon-Containing Hepatoma Cells. J. Virol.
77: 2029-2037
[Abstract]
[Full Text]
-
Fata, C. L., Sawicki, S. G., Sawicki, D. L.
(2002). Alphavirus Minus-Strand RNA Synthesis: Identification of a Role for Arg183 of the nsP4 Polymerase. J. Virol.
76: 8632-8640
[Abstract]
[Full Text]
-
Fata, C. L., Sawicki, S. G., Sawicki, D. L.
(2002). Modification of Asn374 of nsP1 Suppresses a Sindbis Virus nsP4 Minus-Strand Polymerase Mutant. J. Virol.
76: 8641-8649
[Abstract]
[Full Text]
-
Merits, A., Vasiljeva, L., Ahola, T., Kääriäinen, L., Auvinen, P.
(2001). Proteolytic processing of Semliki Forest virus-specific non-structural polyprotein by nsP2 protease. J. Gen. Virol.
82: 765-773
[Abstract]
[Full Text]
-
George, J., Raju, R.
(2000). Alphavirus RNA Genome Repair and Evolution: Molecular Characterization of Infectious Sindbis Virus Isolates Lacking a Known Conserved Motif at the 3' End of the Genome. J. Virol.
74: 9776-9785
[Abstract]
[Full Text]
-
Liang, Y., Gillam, S.
(2000). Mutational Analysis of the Rubella Virus Nonstructural Polyprotein and Its Cleavage Products in Virus Replication and RNA Synthesis. J. Virol.
74: 5133-5141
[Abstract]
[Full Text]
-
You, S., Padmanabhan, R.
(1999). A Novel in Vitro Replication System for Dengue Virus. INITIATION OF RNA SYNTHESIS AT THE 3'-END OF EXOGENOUS VIRAL RNA TEMPLATES REQUIRES 5'- AND 3'-TERMINAL COMPLEMENTARY SEQUENCE MOTIFS OF THE VIRAL RNA. J. Biol. Chem.
274: 33714-33722
[Abstract]
[Full Text]
-
Steffens, S., Thiel, H.-J., Behrens, S.-E.
(1999). The RNA-dependent RNA polymerases of different members of the family Flaviviridae exhibit similar properties in vitro. J. Gen. Virol.
80: 2583-2590
[Abstract]
[Full Text]
-
ten Dam, E., Flint, M., Ryan, M. D.
(1999). Virus-encoded proteinases of the Togaviridae. J. Gen. Virol.
80: 1879-1888
[Full Text]
-
Frolov, I., Agapov, E., Hoffman, T. A. Jr., Prágai, B. M., Lippa, M., Schlesinger, S., Rice, C. M.
(1999). Selection of RNA Replicons Capable of Persistent Noncytopathic Replication in Mammalian Cells. J. Virol.
73: 3854-3865
[Abstract]
[Full Text]