Previous Article | Next Article 
Journal of Virology, October 1998, p. 7722-7732, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Cytomegalovirus Assembly Protein Precursor and
Proteinase Precursor Contain Two Nuclear Localization Signals That
Mediate Their Own Nuclear Translocation and That of the Major
Capsid Protein
Scott M.
Plafker
and
Wade
Gibson*
Virology Laboratories, Department of
Pharmacology and Molecular Sciences, Baltimore, Maryland 21205
Received 6 March 1998/Accepted 12 June 1998
 |
ABSTRACT |
The cytomegalovirus (CMV) assembly protein precursor (pAP)
interacts with the major capsid protein (MCP), and this interaction is
required for nuclear translocation of the MCP, which otherwise remains
in the cytoplasm of transfected cells (L. J. Wood et al., J. Virol. 71:179-190, 1997). We have interpreted this finding to indicate
that the CMV MCP lacks its own nuclear localization signal (NLS) and
utilizes the pAP as an NLS-bearing escort into the nucleus. The CMV pAP
amino acid sequence has two clusters of basic residues (e.g., KRRRER
[NLS1] and KARKRLK [NLS2], for simian CMV) that resemble the simian
virus 40 large-T-antigen NLS (D. Kalderon et al., Cell 39:499-509,
1984) and one of these (NLS1) has a counterpart in the pAP homologs of
other herpesviruses. The work described here establishes that NLS1 and
NLS2 are mutually independent NLS that can act (i) in cis
to translocate pAP and the related proteinase precursor (pNP1) into the
nucleus and (ii) in trans to transport MCP into the
nucleus. By using combinations of NLS mutants and carboxy-terminal
deletion constructs, we demonstrated a self-interaction of pAP and
cytoplasmic interactions of pAP with pNP1 and of pNP1 with itself. The
relevance of these findings to early steps in capsid assembly, the
mechanism of MCP nuclear transport, and the possible cytoplasmic
formation of protocapsomeric substructures is discussed.
 |
INTRODUCTION |
Herpesvirus capsids assemble in the
nucleus during the late phase of infection. The outer shell of the
capsid is composed of four protein species; in cytomegalovirus (CMV)
these are called the major capsid protein (MCP; e.g., human CMV
[HCMV] UL86, 154 kDa), the minor capsid protein (mCP; e.g., HCMV
UL85, 34 kDa), the minor capsid-binding protein (mCBP; e.g., HCMV UL46,
33 kDa), and the smallest capsid protein (e.g., HCMV UL48/49, 8.5 kDa). Organization of these four proteins into a capsid appears to be coordinated by two genetically related, internally situated proteins, in CMV called the proteinase precursor (pNP1; e.g., HCMV UL80a, 74 kDa)
and the assembly protein precursor (pAP; e.g., HCMV UL80.5, 38 kDa).
During CMV capsid maturation, the internal proteins are cleaved by
the autocatalytic proteinase [(pNP1
NP1 + tail;
NP1
NP1c + NP1n;
NP1n
An + Ac) and (pAP
AP + tail)], and most, if not all, of the cleavage products are eliminated
from the particle in conjunction with DNA packaging (reviewed in
reference 22).
In addition to the transient but essential roles played by the CMV
proteinase and assembly protein precursors, both are distinguished among the capsid proteins in several ways: (i) pNP1 and pAP are genetically related by the overlapping, 3' coterminal arrangement of
the genes encoding them (60) (thus, pNP1 is an
amino-terminal, in-frame extension of pAP) (Fig. 1); (ii) both are
proteolytically processed (23, 62) and are modified by
phosphorylation (21, 23, 32, 44b, 49); and (iii) both
interact with the CMV MCP through a 21-amino-acid carboxyl conserved
domain and self-interact through a 19-amino-acid amino conserved domain
(63). The herpes simplex virus (HSV) pAP homolog, pVP22a
(ICP35c,d), has similar characteristics (14, 24, 31, 38, 44,
45).
Insight into the functional significance of the intermolecular
interaction between pAP and MCP was obtained by using a transient transfection/intracellular localization assay based on indirect immunofluorescence (IF). In this assay system, the CMV MCP does not
enter the nucleus when expressed alone but is efficiently transported
into the nucleus by pAP and not by its cleavage product, AP
(63). Similar results were found with the counterpart
proteins of HSV, although exclusion of HSV MCP from the nucleus appears to be less complete (36, 42, 47) (see Fig. 5B). We
interpreted these observations as indicating that the CMV MCP lacks its
own nuclear localization signal (NLS), forms an MCP-pAP complex in the
cytoplasm, and through this complex takes advantage of NLS present in
pAP for transport into the nucleus.
Inspection of the amino acid sequences of the HCMV and simian CMV
(SCMV) proteinase and assembly protein precursors revealed two
well-conserved sequences, designated NLS1 and NLS2 (Fig. 1), resembling
the simian virus 40 (SV40) large-T-antigen NLS.
The work described here was done to
determine whether these sequences have a role in mediating the nuclear
translocation of pNP1 and pAP and identify the complexes they form with
themselves and with MCP.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Landmarks of the SCMV pNP1 and pAP. Landmarks and
abbreviations are as follows: NLS1 (dark gray rectangles) and NLS2
(light gray rectangles); N1 (empty oval) and C1 (filled oval), which
represent, respectively, the 13-amino-acid amino-terminal sequence and
21-amino-acid carboxy-terminal sequence used to prepare the antipeptide
antisera, anti-N1 and anti-C1 (53); the maturational (M;
VNA S), release (R; YVKA S), and internal (I; INA A) sites that
are cleaved autoproteolytically by pNP1 (or assemblin) to eliminate the
tail (61, 62), free the amino terminal 28-kDa proteolytic
domain (assemblin) (61), and convert assemblin from a
one-chain to a two-chain enzyme (29, 30); and X, which
represents mutation S118A that replaces the catalytic
nucleophile and inactivates the proteinase (61).
Designations for the proteinase precursor (pNP1), a proteolytically
inactive form of pNP1 (S118A) and its mature form cleaved
at the M site (S118A.m), the assembly protein precursor
(pAP) and its mature form (AP), and the carboxyl tail removed by M-site
cleavage are indicated at the left of each line, and the corresponding
molecular weight (103) is indicated at the right. The amino
acid sequences of NLS1 and NLS2 are given at the lower left.
|
|
 |
MATERIALS AND METHODS |
Cells and transfection.
African green monkey kidney cells
transformed with the SV40 large-T-antigen gene (COS-7 cells; ATCC CRL
1651; American Type Culture Collection, Rockville, Md.) were grown in
Dulbecco's modified eagle medium (catalog no. 12100-061; GIBCO, Grand
Island, N.Y.) supplemented with fetal calf serum (10%), penicillin
(100 U/ml), streptomycin (100 U/ml), and nystatin (10 U/ml).
Transfections were done in COS-7 cells by using either a calcium
phosphate (61) or DEAE-dextran (63) procedure, as
described before.
Plasmid construction.
The construction, cloning, and
propagation of plasmids were carried out by standard techniques
(52), and mutations were confirmed by automated DNA sequence
analysis at the JHMI Core DNA Analysis Facility or Protein/Peptide/DNA
Laboratory.
The parental plasmids were (i) AW2, the SCMV pAP gene in pGEM-4Z
(
62); (ii) AW48, the SCMV gene for inactive proteinase
precursor (S
118A.L) in pRSV.5neo (
61); and (iii)
SP1, the AW2
plasmid modified to contain a unique
XhoI site
and encoding a
serine codon-to-glycine codon mutation at residue 144. Other plasmids
used included MB30, a pcDNA/AMP I construct encoding the
HCMV
MCP (
63), and AW1, which contains the SCMV pAP gene in
pRSV.5neo
(
62).
NLS mutations were made as follows. pAP/NLS1

was made in
SP1 by changing NLS1 from KRRRER
153 to AAAAEA through
oligonucleotide-directed
mutagenesis. The sequence between
XhoI and
MluI was replaced with
the
oligonucleotide TCGAGATCTGGGGCCCTTGCTGCTGCTGCTGAAGCTGA
annealed
to a complementary strand such that a 5'
XhoI
and a 3'
MluI overhang
resulted. This oligonucleotide
returns Ala144 to wild-type Ser144.
NLS2

was made in AW2
by changing NLS2 from KARKRLK
179 to AAAAALA by
replacing the wild-type fragment between
MluI and
StyI with the
oligonucleotide
CGCGTCGAGTGATGAGGAAGAGGACATGAGTTTTCCCGGGGAAGCTGATCATGGCGCGGCTGCTGCAGCGCTGGCTGCTCATCACGGTCGCGATAATAACAACTCAGGTTCAGATGC
annealed to a complementary strand such that a 5'
MluI
and a 3'
StyI overhang resulted. pAP/NLS1,2

contains both the NLS1

and NLS2

mutations
and was made by replacing the wild-type fragment between
MluI and
StyI of the NLS1

construct
with the NLS2

mutational oligonucleotide. All three
mutants were subcloned
into pRSV.5neo by cleaving the pGEM-4Z plasmids
with
SalI and
BamHI and ligating the respective
genes into the
SalI/
BamHI polylinker
sites of
pRSV.5neo.
Each of the three NLS mutations was subcloned into the proteolytically
inactive SCMV proteinase precursor, S
118A.L, to generate
S
118A/NLS1

,
S
118A/NLS2

, and
S
118A/NLS1,2

. This was done by replacing the
DraIII/
BamHI fragment of AW48
with the
corresponding fragment from each of the three mutants.
The mature form of the inactive, full-length proteinase
(S
118A.m; stops at VNA_ of the M site [Fig.
1]), was
constructed by
replacing the small
DraIII/
BamHI
fragment of AW48 with the corresponding
DraIII/
BamHI fragment from AP.RSV.5neo, a plasmid
encoding the
SCMV AP (
63). S
118A.m containing
the NLS1,2 mutation was made
by replacing the small
DraIII/
BamHI fragment of S
118A.m.
with
the corresponding
DraIII/
BamHI fragment from
AP/NLS1,2

.
AP/NLS1

, AP/NLS2

, and
AP/NLS1,2

were made by replacing the 1,117-bp
Bsu36I fragment of AP.RSV.5neo with the corresponding
1,117-bp
Bsu36I fragment from the respective pAP mutants.
The

-galactosidase (

-Gal) fusion constructs were made by first
ligating a PCR-generated
lacZ gene into the
BamHI
site of
the pRSV.5neo polylinker to give LacZ.RSV.5neo. The NLS1, NLS2,
or NLS1,2 coding sequences, preceded by a translational start
codon,
were then inserted, in frame, at the
NotI site 5' of the
lacZ sequence. This cloning strategy introduced an Ala
triplet
between the NLS and
lacZ sequence.
IF.
Seventy-two hours after addition of the DNA, transfected
cells were processed for indirect IF as described previously
(63) and typically photographed at a magnification of ×40
and exposure time of 40 s, using an Olympus BH-2 microscope and
Kodak Ecktachrome Elite, ASA 400 film. The primary antibodies were (i)
anti-N1, a polyclonal antipeptide rabbit antiserum raised against a
peptide representing residues 2 to 14 of the SCMV AP (53),
diluted at 1:80 in 5% bovine serum albumin-10 mM Tris-0.15 M
NaCl-0.02% sodium azide, pH 7.4 (TN/BSA); (ii) anti-C1, a polyclonal
antipeptide rabbit antiserum raised against a peptide representing the
carboxy-terminal 21 residues of the SCMV pAP (53), diluted
at 1:80 in TN/BSA; (iii) anti-MCP, a polyclonal antipeptide rabbit
antiserum raised against a peptide representing the carboxy-terminal 15 residues of the AD169 HCMV MCP (63), diluted at 1:500 in
TN/BSA; and (iv) anti-
-Gal, a mouse monoclonal antibody to
Escherichia coli
-Gal (catalog no. 1083104; Boehringer
Mannheim, Indianapolis, Ind.), diluted at 1:250 in TN/BSA. The
secondary antibodies were (i) fluorescein isothiocyanate-labeled goat
anti-rabbit antibodies (catalog no. 111-095-144; Jackson
Immunolaboratories, Inc., West Grove, Pa.) diluted 1:150 in TN/BSA and
(ii) fluorescein isothiocyanate-labeled goat anti-mouse antibodies
(catalog no. 115-095-062; Jackson Immunolaboratories) diluted 1:150 in
TN/BSA.
 |
RESULTS |
NLS1 and NLS2 functionality was evaluated by testing their ability
to translocate target proteins from the cytoplasm into the nucleus, as
determined by IF assays of transfected cells. The SCMV assembly protein
and proteinase precursors used in this study are illustrated in Fig. 1.
To ensure that interpretation of results would not be complicated by
the ability of the 34-kDa pAP to enter the nucleus by non-NLS-mediated
diffusion (i.e., excluded size of
40 to 60 kDa) (5, 43),
experiments to study these NLS in their native context were done first
by using the genetically related 64-kDa proteinase precursor (pNP1). An
inactive mutant of the proteinase (S118A
[61]) was used to prevent its autoproteolytic cleavage
at the M, R, and I sites. Corresponding experiments done with pAP,
despite its small size, are also described.
NLS1 and NLS2 promote nuclear translocation of
-Gal.
Initial experiments tested the ability of NLS1 and NLS2 to direct a
normally cytoplasmic protein,
-Gal, into the nucleus. NLS1, NLS2, or
the entire NLS1,2 region (i.e., amino acids 148 to 179) was fused to
the amino terminus of
-Gal to create
-Gal/NLS1,
-Gal-NLS2, and
-Gal/NLS1,2, respectively. The fusion proteins were separately
expressed by transfecting COS-7 cells, and 72 h later their
intracellular distribution was determined by IF assay.
Wild-type

-Gal was essentially excluded from the nucleus (Fig.
2A), due to its large size (116 kDa) and
lack of an NLS (
25).

-Gal/NLS1, in contrast, was detected
primarily in the nucleus
(Fig.
2C) but with some cytoplasmic
fluorescence evident;

-Gal/NLS2
was also mainly nuclear (Fig.
2B)
but showed more cytoplasmic
fluorescence than

-Gal/NLS1, indicating
that both of these CMV
NLS are functional and that NLS1 is inherently
stronger than NLS2.

-Gal/NLS1,2 showed the strongest nuclear
localization (Fig.
2D),
indicating that the two signals work
additively, as observed for
other NLS (reviewed in reference
20).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 2.
-Gal fusions with NLS1 or NLS2 localize to the
nucleus. COS-7 cells were transfected with plasmids encoding
-Gal/NLS fusion proteins and analyzed 3 days later by indirect IF
using a monoclonal antibody to -Gal, all as described in the text.
Shown are photomicrographs of the resulting cells expressing -Gal
(A), -Gal/NLS2 (B), -Gal/NLS1 (C), or -Gal/NLS1,2 (D).
|
|
Mutation of NLS alters intracellular distribution of pNP1 and
pAP.
NLS1 and NLS2 were mutated individually or together to
determine their influence on the intracellular localization of the mutant proteinase precursor, S118A. The basic residues of
each NLS were replaced with alanines, and the intracellular
distribution of the mutants was determined by IF assay.
S118A and S118A/NLS2
both
localized to the nucleus (Fig. 3A and C,
respectively), and S118A/NLS1
also
distributed primarily to the nucleus but showed some fluorescence in
the cytoplasm (Fig. 3B). However, when neither NLS was present (S118A/NLS1,2
), the protein was essentially
excluded from the nucleus and distributed throughout the cytoplasm
(Fig. 3D), demonstrating that either NLS1 or NLS2 is required for
nuclear localization of the proteinase precursor. These results also
indicate that pNP1 does not contain NLS other than NLS1 and NLS2.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
S118A requires NLS1 or NLS2 for its nuclear
transport. COS-7 cells were transfected with plasmids encoding either
S118A or its NLS mutants and analyzed 3 days later by
indirect IF assay using anti-N1, as described in the text. Shown are
photomicrographs of representative cells expressing S118A
(A), S118A/NLS1 (B),
S118A/NLS2 (C), and
S118A/NLS1,2 (D).
|
|
The experiment was repeated with the NLS mutations in the context of
pAP. Cells were transfected with plasmids encoding either
wild-type pAP
or its NLS mutants, and the intracellular distribution
of the proteins
was determined. When both NLS were present (pAP
[Fig.
4A]) or just NLS1 was present
(pAP/NLS2

[Fig.
4C]), the protein localized strongly to
the nucleus. When
only NLS2 was present (pAP/NLS1

[Fig.
4B]), the protein also localized to the nucleus but some
cytoplasmic
fluorescence was detected, as noted with the corresponding
NLS1

constructs,

-Gal/NLS2 (Fig.
2B) and
S
118A/NLS1

(Fig.
3B). When both NLS were
mutated to give pAP/NLS1,2

, all cells showed increased
levels of cytoplasmic fluorescence,
due to the absence of active
NLS-mediated nuclear translocation.
However, because
pAP/NLS1,2

, unlike
S
118A/NLS1,2

, can enter the nucleus by
passive diffusion, its phenotype was
varied: in some cells cytoplasmic
fluorescence was predominant
(Fig. 4D1); in others cytoplasmic and
nuclear fluorescence were
comparable (Fig. 4D2); and in some nuclear
fluorescence was predominant
(Fig. 4D3), but no cells showed the
essentially exclusive nuclear
fluorescence observed with wild-type pAP
(Fig.
4A).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
NLS1 and NLS2 enhance nuclear localization of pAP. COS-7
cells were transfected with plasmids encoding either pAP or its NLS
mutants and analyzed 3 days later by indirect IF assay using anti-N1,
all as described in the text. Shown are photomicrographs of
representative cells expressing wild-type pAP (A),
pAP/NLS1 (B), pAP/NLS2 (C), and
pAP/NLS1,2 , which had a comparatively heterogeneous
distribution of fluorescence (D).
|
|
NLS mutations in the proteinase and assembly protein precursors
affect nuclear translocation of MCP.
Nuclear translocation of the
CMV MCP requires its interaction with pAP (63) or pNP1
(shown below), suggesting that NLS1 or NLS2, or both, functions in
trans to enable the resulting MCP complexes to enter the
nucleus. This was tested by comparing the intracellular distribution of
MCP expressed alone or coexpressed with S118A or its NLS
mutants. The HCMV MCP was used in place of the SCMV MCP in these
studies because it was more easily detected and photographed in the IF
assays. This substitution is justified on the basis that (i) the amino
acid sequence of the SCMV and HCMV MCPs are 78% identical
(44a); (ii) the SCMV pAP interacts specifically (i.e., via
its carboxyl end) with the HCMV MCP (63); (iii) NLS1 and
NLS2 are highly conserved between the SCMV and HCMV pAP homologs (see
Fig. 11); and (iv) comparable, but essentially undocumentable (i.e.,
fluorescence too weak), results were obtained in assays using the
homologous SCMV MCP-pAP pair (data not shown). The HSV MCP was also
expressed alone for comparison.
When the HCMV MCP was expressed alone, it distributed throughout the
cytoplasm but was excluded from the nucleus (Fig.
5A).
In contrast, the distribution of the
HSV MCP was both cytoplasmic
and nuclear (Fig.
5B), as observed by
others (
36,
42,
47).
When the HCMV MCP was coexpressed with
S
118A, S
118A/NLS1

, or
S
118A/NLS2

, both MCP (Fig.
6A, B, or
C, respectively) and the corresponding
NLS-bearing escort (Fig.
6E, F, or G, respectively) localized
to the
nucleus. However, when MCP was coexpressed with the NLS-deficient
escort, S
118A/NLS1,2

, neither protein entered
the nucleus and predominantly cytoplasmic
immunofluorescence was
observed (Fig.
6D and H). These findings
are consistent with both NLS1
and NLS2 being able to act in
trans,
via
S
118A-MCP complex formation, as signals for HCMV MCP
nuclear
translocation. Because both NLS function in this capacity,
these
results also indicate that neither is selectively masked by the
S
118A-MCP interaction.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 5.
When expressed alone, the HCMV MCP is excluded from the
nucleus, but the HSV-1 MCP is not. COS-7 cells were transfected with
plasmids encoding either the HCMV MCP or its HSV-1 counterpart, VP5,
and analyzed 3 days later by indirect IF assay using antisera to the
HCMV MCP (A) or to the HSV MCP, VP5 (B), all as described in the text.
Shown are photomicrographs of representative immunopositive cells.
|
|

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Nuclear transport of MCP by S118A requires
NLS1 or NLS2. COS-7 cells were cotransfected with plasmids encoding the
HCMV MCP, together with either S118A or its NLS mutants,
and analyzed 3 days later by indirect IF assay using either anti-MCP
(63) (A to D) or anti-N1 (E to H), all as described in the
text. Shown are photomicrographs of representative cells coexpressing
MCP with S118A (A and E),
S118A/NLS1 (B and F),
S118A/NLS2 (C and G), or
S118A/NLS1,2 (D and H).
|
|
When this experiment was repeated using the same NLS mutations in the
context of pAP, both MCP (Fig.
7A to C)
and its NLS-bearing
escorts (pAP, pAP/NLS1

, and
pAP/NLS2

) (Fig.
7E to G) localized to the nucleus, as
observed above for
the corresponding S
118A constructs.
Unexpectedly, MCP-specific
fluorescence was also detected in the nuclei
of some cells coexpressing
MCP and the NLS

mutant,
pAP/NLS1,2

(Fig.
7D). Such nuclear fluorescence was not
observed for the
corresponding proteinase construct
(S
118A/NLS1,2

[Fig.
6D]) and is attributed
to diffusion of the comparatively
smaller pAP/NLS1,2

into
the nucleus (Fig.
7H) and its trapping there of immunoreactive
breakdown fragments of MCP, as discussed below.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 7.
NLS present in pAP mediate nuclear transport of MCP.
COS-7 cells were cotransfected with plasmids encoding the HCMV MCP and
either wild-type or NLS mutant pAP proteins and analyzed 3 days later
by indirect IF assay using anti-MCP (A to D) or anti-N1 (E to H), all
as described in the text. Shown are photomicrographs of representative
cells coexpressing MCP with pAP (A and E), pAP/NLS1 (B
and F), pAP/NLS2 (C and G), and pAP/NLS1,2
(D and H). Note focal pattern of intranuclear MCP fluorescence when
expressed with pAP (A).
|
|
Proteinase precursor interacts with itself and with pAP in the
cytoplasm.
The proteinase precursor interacted with itself and
with the pAP when tested in the GAL4 two-hybrid system (63).
The experiments described below were done to determine whether these
interactions can take place in the cytoplasm and, if so, whether they
mask the function of either NLS. The NLS+ M-site-cleaved
forms of S118A and pAP (i.e., S118A.m and AP, terminating at the M-site P1 alanine [Fig. 1]) were used as test escorts. Because these escorts lack the 33-amino-acid carboxyl tail,
which includes the 21-amino-acid sequence used to prepare the anti-C1
antiserum (53), they are immunologically invisible to
anti-C1 and enable the intracellular distribution of the
S118A/NLS1,2
target to be selectively
determined by IF assay.
The proteinase self-interaction was tested by using
S
118A/NLS1,2

as the NLS

target
and S
118A.m as the NLS
+ escort. When expressed
alone, the S
118A/NLS1,2

target was excluded
from the nucleus (Fig.
8B), as observed
above
(Fig.
3D), and the S
118A.m escort localized entirely
within the
nucleus (Fig.
8A). But when the two were coexpressed, the
S
118A/NLS1,2

target was translocated into the
nucleus (Fig.
8C). Nuclear fluorescence
was not detected when
S
118A/NLS1,2

was coexpressed with the same
escort lacking NLS (i.e., S
118A.m/NLS1,2

[Fig.
8D]), indicating that at least one NLS per complex is needed
for its nuclear translocation. These data indicate that the
S
118A/NLS1,2

mutant is sufficiently soluble
to undergo nuclear translocation,
corroborate the S
118A
self-interaction detected in GAL4 two-hybrid
assays (
63),
and demonstrate that the interaction can take place
in the cytoplasm.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 8.
Precursor proteinase can self-interact in the cytoplasm
of transfected cells. COS-7 cells were transfected with plasmids
encoding different constructs of the proteinase precursor and analyzed
3 days later by indirect IF using anti-N1 (A) or anti-C1 (B to D), all
as described in the text. Shown are photomicrographs of representative
cells expressing the NLS+ S118A.m escort alone
(A), the S118A/NLS1,2 target alone (B), and
the S118A/NLS1,2 target together with the
S118A.m escort (C) or together with the NLS
S118A.m/NLS1,2 escort (D).
|
|
Interaction of the proteinase with pAP was tested next by expressing
S
118A/NLS1,2

alone (e.g., Fig.
3D and
8B) or
together with an AP escort containing
both, one, or neither NLS. When
S
118A/NLS1,2

was coexpressed with AP (Fig.
9A1 and A2), AP/NLS1

(Fig.
9B), or AP/NLS2

(Fig.
9C), most of the fluorescence was
nuclear, indicating the
formation and nuclear translocation of
cytoplasmic complexes composed
of the two proteins. Some nuclei in
cells coexpressing S
118A/NLS1,2

and AP showed
a pattern of focally concentrated fluorescence
(e.g., Fig. 9A2) that
was not observed with any of the three AP/NLS
mutants. Some nuclear
fluorescence of S
118A/NLS1,2

was also
observed when it was coexpressed with an NLS-deficient
AP escort (i.e.,
AP/NLS1,2

[Fig.
9D]). This result may be due to a
trapping effect similar
to that suggested above to explain the
unanticipated nuclear fluorescence
observed when the MCP target and
pAP/NLS1,2

escort were coexpressed and is discussed
below.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 9.
Demonstration of AP-proteinase precursor interaction in
cytoplasm. COS-7 cells were cotransfected with plasmids encoding
S118A/NLS1,2 and AP or its NLS mutants and
analyzed 3 days later by indirect IF assay using anti-C1 to determine
the intracellular distribution of
S118A/NLS1,2 , all as described in the text.
Shown are photomicrographs of representative cells coexpressing
S118A/NLS1,2 with AP (A),
AP/NLS1 (B), AP/NLS2 (C), or
AP/NLS1,2 (D). Note greater coalescence of
S118A/NLS1,2 fluorescence when the AP escort
contained both NLS (e.g., top cell in panel A1 and left cell in panel
A2).
|
|
The pAP self-interaction was also tested, even though both target and
escort can enter the nucleus by diffusion (e.g., Fig.
4D). The target
protein was NLS

pAP (i.e., mutant
pAP/NLS1,2

), the escort was NLS
+ mature AP,
and the target-specific antiserum was anti-C1. Expression
of the
NLS

target alone resulted in both cytoplasmic and nuclear
fluorescence
(Fig.
10A), as observed in
Fig.
4D. Expression of the NLS
+ escort alone gave a
distribution of nucleus-only fluorescence
(Fig.
10F), with what
appeared to be a more punctate or coalesced
pattern than was observed
with the precursor, pAP (e.g., Fig.
4A). Coexpression of the target and
escort in an equimolar ratio
(i.e., based on input plasmid
concentrations) resulted in a noticeable
shift toward a more nuclear
distribution of fluorescence (Fig.
10B). When the amount of
escort-encoding plasmid was increased
to two-, four-, and eightfold
above that of the target (Fig.
10C,
D, and E, respectively), the
distribution of fluorescence became
progressively more nuclear (compare
Fig.
10B and C) and then more
punctate (compare Fig.
10C and D with
Fig.
10E). Thus, despite the
small size of these proteins, a pAP-AP
interaction was evident
from the more complete nuclear localization of
the NLS

pAP target when it was coexpressed with
NLS
+ AP escorts. We observed that the number of fluorescent
cells
was consistently higher in the coexpressions than when
pAP/NLS1,2

was expressed alone, and we suspect that this
phenomenon is caused
by masking of the C1 epitope when pAP is expressed
alone. Consistent
with this explanation, Western immunoassays done as
part of a
similar experiment revealed that although pAP target protein
fluorescence
increased in the coexpressions, the amount of target
protein itself
did not increase; in fact, it decreased as the amount of
escort
increased (data not shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 10.
pAP self-interacts in the absence of other viral
proteins. COS-7 cells were transfected with plasmids encoding
pAP/NLS1,2 (target) alone, AP (escort) alone (F), or
pAP/NLS1,2 together with increasing amounts of AP (B to
E). The intracellular localization of pAP/NLS1,2 was
determined by indirect IF assay using anti-C1 (A to E), and the
distribution of AP alone was determined by using anti-N1 (F), all as
described in the text. In cotransfections, the molar ratios of the
pAP/NLS1,2 to AP plasmid were 1:1 (B), 1:2 (C), 1:4 (D),
and 1:8 (E). Shown are representative cells from each transfection.
Note the greater coalescence of fluorescence (i.e., speckles and spots)
in panels E and F.
|
|
 |
DISCUSSION |
We have identified two SV40 large-T-antigen-like NLS in the CMV
pAP. The functionality and relative strengths of these sequences, called NLS1 and NLS2, were established by showing that each could change the localization of
-Gal (116 kDa) from cytoplasmic to nuclear when fused to its amino terminus.
Mutagenesis experiments showed that both NLS were also functional in
their native context. An enzymatically inactive mutant of the
proteinase precursor pNP1 (i.e., S118A
[61]), which has the entire pAP sequence as its
carboxyl half (Fig. 1), was used because its larger size (64 kDa,
versus 34 kDa for the pAP) prevents it from entering the nucleus by
non-NLS-mediated diffusion. Nuclear localization of S118A
occurred when either NLS1 or NLS2 was intact; when both were mutated,
the protein remained in the cytoplasm (Fig. 3D). Consistent results
were obtained when these experiments were done with pAP (Fig. 4), but,
as expected, their interpretation was complicated by its smaller size
and ability to diffuse into the nucleus.
NLS1 was functionally somewhat stronger than NLS2, as evidenced by its
better ability to promote nuclear translocation of
-Gal,
S118A, and pAP when acting in cis. Only NLS1 has
an apparent counterpart among the pAP homologs of all herpesviruses
(Fig. 11), indicating that it may be
the functionally more important of the two. NLS2, however, is conserved
among all betaherpesvirus pAP homologs, suggesting that it satisfies a
group-specific requirement. Noteworthy in this regard is that, in
addition to their NLS being closely symmetric with respect to the
putative helix-breaking PGE/D motif, the termini of the betaherpesvirus
pAP homologs are also more symmetric about this motif than are those of
the pAP homologs of most other herpesviruses (Fig. 11).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 11.
Positional homologs of NLS1 and NLS2 in the pAP
homologs of herpes-group viruses. Amino acid sequences of available pAP
homologs were aligned by using the Pima program (Baylor College of
Medicine), and positional homologs of CMV pAP NLS1 and NLS2 were
identified as indicated. A conserved Pro-Gly-Glu/Asp (PGE/D) sequence
is indicated as an internal reference, and the carboxy-terminal amino
acid number for each sequence is given. Sequences were obtained from
GenBank; the viruses are as follows: HSV-1 (40), HSV-2
(54), equine herpesvirus 1 (EHV-1) (57),
varicella-zoster virus (VZV) (12), infectious
laryngotracheitis virus (ILTV) (27), pseudorabies virus
(PRV) (7), bovine herpesvirus 1 (BHV-1) (28),
HCMV strain AD169 (9), SCMV strain Colburn (60),
human herpesvirus 6 (HHV-6) (26), human herpesvirus 7 (HHV-7) (41), murine CMV (MCMV) (39),
Epstein-Barr virus (EBV) (2), equine herpesvirus 2 (EHV-2)
(56), herpesvirus saimiri (HVS) (1), human
herpesvirus 8 (HHV-8) (51), wildebeest herpesvirus (AHV-1)
(17), murine herpesvirus 68 (MHV68) (59), and
channel catfish virus (CCV) (11). Classification as alpha-,
beta-, or gammaherpesvirus is based on the nomenclature of Roizman et
al. (50). The amino acid sequence of the SV40
large-T-antigen NLS (33, 34) is shown at the bottom.
|
|
Having established that NLS1 and NLS2 can each function independently
as a transport signal, experiments were done to test whether these
sequences provide a mechanism, through pAP-MCP complex formation, to
enable MCP nuclear translocation. This possibility was suggested to
explain the findings that for both CMV and HSV type 1 (HSV-1), nuclear
transport of MCP requires (63) or is enhanced by
(42) coexpression with their respective pAP, both of which
contain an NLS1 motif (Fig. 11 and reference 19).
This mechanism is supported for CMV by the finding that either NLS1 or
NLS2 must be present in pAP (or pNP1) to mediate MCP nuclear translocation, and as observed in the
-Gal and S118A
self-translocation experiments, both must be present for maximal
effect. Although this finding ascribes a functional role to at least
one of these NLS (i.e., promote nuclear translocation of MCP), it does
not explain the presence of two in the CMV pAP.
Other proteins with multiple NLS have been described. In some
instances, one NLS overlaps a DNA- or protein-binding domain (4,
58), whose interaction may block that NLS and create the need for
a compensating second NLS. In another instance, a sequence that
functioned alone as an NLS in a heterologous fusion protein did not
function alone as an NLS in its native context (10). We
considered the possibility that multiple NLS could be required to
maintain presentation of at least one signal as the protein changes
conformation or interacts with other molecules, but our experiments
provided no support for this. Both NLS1 and NLS2 were functional in
their native context, and their strengths were NLS1 + NLS2 > NLS1
NLS2, whether their effect was exerted in cis
(Fig. 2 to 4) or in trans (Fig. 6, 7, and 9).
The possibility that the two NLS act additively to enhance the
efficiency of transporting the large cytoplasmic complexes that result
from pAP, pNP1, and MCP interactions could not be readily tested in
these IF assays but is fully compatible with our results. The ability
of multiple NLS to enlarge the channel of the nuclear pore complex
(16), or increase the rate and extent of nuclear
accumulation (15, 16, 37, 48), has been demonstrated in
other systems (reviewed in reference 20). This
explanation for the two NLS in CMV pAP could account for the difference
in nuclear localization between the CMV and HSV MCPs, if (i) optimal localization of pAP-MCP complexes requires two NLS equivalents, as
indicated here for CMV, and (ii) these signals can be contributed by
either protein. Thus, the CMV MCP, which has no intrinsic ability to
enter the nucleus when expressed alone (Fig. 5A and reference 63), has no NLS and depends on its pAP or pNP1
escort to provide both. In contrast, the HSV MCP, which does have some
ability to enter the nucleus when expressed alone (Fig. 5B and
references 36, 42, and 47), may
contribute one NLS equivalent itself and depend on its pAP or pNP1
escort homolog for only one additional NLS. This interpretation could
include as yet undetected MCP sequences (e.g., an endogenous nuclear
export signal that overrides a possible endogenous NLS) that may be
involved in the overall transport process. Alternatively, the apparent
nuclear localization difference between the CMV and HSV MCPs expressed
alone could result from (i) a comparatively greater breakdown of the
HSV MCP, resulting in the diffusion of immunoreactive fragments into
the nucleus, or (ii) an interaction of the HSV MCP with a host escort
(55) that partially substitutes for the HSV pAP homolog,
pVP22a (ICP35c,d).
The ability of pAP and pNP1 to participate in self-interactions, and to
interact with one another and with MCP, was demonstrated previously by
using the GAL4 two-hybrid system (63). In the same study,
these interactions were related to the capsid assembly pathway by two
other observations, namely, that nuclear transport of MCP depends on
pAP-MCP complex formation and that pAP multimerization promotes the
pAP-MCP interaction. These findings, and similar studies with the HSV-1
counterparts of pAP and MCP (i.e., pVP22a and VP5, respectively)
(42, 44), suggest that an ordered association of capsid
proteins takes place in the cytoplasm, proceeding from initial
interactions of pAP and pNP1 to form homo- and/or hetero-oligomers, to
their interaction with MCP to form precapsomeric complexes, and
possibly to the formation of protocapsomers that could be translocated
into the nucleus for capsid assembly. Features of this model provide
mechanisms for (i) potentiating or stabilizing pAP (or pNP1)
interaction with MCP, (ii) promoting delivery of MCP to the nucleus,
and (iii) ensuring incorporation of the maturational proteinase
precursor, pNP1, into nascently forming capsids.
As a means of determining whether the putative nucleating interactions
in this cascade (i.e., formation of pAP and pNP1 homo- and
hetero-oligomers) can take place in the cytoplasm, as would be
predicted, we assayed for a shift in the intracellular distribution of
NLS mutants of pAP and pNP1 when coexpressed with NLS+
escorts. Our results demonstrated that the pNP1 self-interaction (Fig.
8) and the pAP-pNP1 interaction (Fig. 9) can take place in the
cytoplasm, but they did not give unambiguous evidence for cytoplasmic
interaction of pAP because both the target and escort proteins can
diffuse into the nucleus. It would be surprising if pAP did not
self-interact in the cytoplasm, however, given that the closely related
pNP1 (S118A) does (Fig. 8C and 9). Moreover, the
concentration-dependent shift of pAP/NLS1,2
from the
cytoplasm to the nucleus when coexpressed with increasing amounts of
NLS+ escort (Fig. 10) is fully consistent with a
cytoplasmic interaction.
We were surprised that pAP lacking NLS showed some ability to influence
the intracellular distribution of MCP and
S118A/NLS1,2
(Fig. 7D and 9D, respectively)
and suspect that this is due to a fraction of the indicator protein
(i.e., MCP or S118A/NLS1,2
) being broken down
by proteolysis to immunologically reactive fragments able to diffuse
into the nucleus. These fragments could then interact with
NLS
pAP that had also diffused into the nucleus (Fig. 4D)
and form a complex too large to diffuse back out. Consistent with this interpretation, (i) there is some breakdown of MCP and
S118A/NLS1,2
to smaller fragments when
expressed in transfected cells (Western immunoassay [data not shown])
and (ii) the effect was not observed when either MCP or
S118A/NLS1,2
was expressed alone (i.e., no
nuclear pAP or AP to entrap immunoreactive target fragments). An
alternative explanation, namely, that a cryptic NLS is expressed in the
pAP-MCP or AP-S118A complexes, is weakened by the fact that
this effect was not observed when the escort was
S118A/NLS1,2
or
S118A.m/NLS1,2
(Fig. 6D and 8D), which
contain the entire pAP/NLS1,2
or AP/NLS1,2
sequence, respectively (Fig. 1).
In summary, we have shown that the two SV40 T-antigen-like NLS, present
in the CMV pAP and its genetically related pNP1, can effect the nuclear
translocation of pAP and pNP1 by acting in cis and that of
MCP by acting in trans. In addition, our data demonstrate
that multimeric complexes of capsid proteins can form in the cytoplasm
and that their nuclear transport can be mediated by NLS1 and NLS2.
These complexes can consist of pAP-pAP, pNP1-pNP1, pAP-pNP1, pNP1-MCP,
pAP-MCP, and theoretically capsomeric or subcapsomeric assemblages
(e.g., [pAP-MCP]6 protohexamer).
Evidence that such complexes form and are required for nuclear
translocation of specific CMV (63) and HSV (36, 42,
47) proteins has been reported before. The experiments described
here indicate that the underlying reason for this requirement is that not all of the capsid proteins contain the NLS required for efficient translocation into the nucleus. In the case of CMV, NLS present in pAP
and pNP1 act in trans, through pAP-MCP (and pNP1-MCP)
complexes, to enable nuclear translocation of the MCP (Fig. 6 and 7;
reference 63). Similarly, NLS present in another
outer shell protein, the mCBP component of the triplex, also appears to
act in trans, through mCBP-mCP complexes, to enable nuclear
translocation of mCP
its triplex partner (3, 3a). Similar
pairwise interactions between NLS+ and NLS
or
weak NLS+ capsid proteins have been reported for the
DNA-containing papovaviruses, polyomavirus (13, 18) and SV40
(35), and adenovirus (8), suggesting this may be
a general mechanism for nuclear replicating viruses but not explaining
why.
The presence of NLS in proteins destined for incorporation into capsids
forming in the nucleus would be expected to maximize their
concentration in the assembly compartment and to minimize their
concentration in the cytoplasm, where premature capsid formation could
decrease the efficiency of the assembly pathway. Further, by endowing
only one partner (e.g., pAP) of a protein pair (e.g., pAP-MCP) with an
NLS, an additional level of control could be imposed on the flow of
events leading to capsid assembly. For example, if the efficiency or
fidelity of capsid formation were enhanced by the availability of
correctly preassembled subunits (e.g., pAP-MCP complexes),
compartmentalizing the early (e.g., cytoplasmic protein-protein
interactions) and late (e.g., nuclear subunit-subunit interactions)
steps in the pathway could be advantageous. Thus, in CMV the essential
capsid proteins would be supplied to the nucleus as preformed
pAP-(and/or pNP1-)-MCP or mCP-mCBP subunits, thereby reducing the
chances of incorporating a misfolded substituent into the nascent
capsid or having a stoichiometric imbalance of capsid proteins in the
assembly compartment. These speculations predict that a CMV mutant
virus lacking NLS in both pAP and mCBP would give rise to cytoplasmic
capsids and have a higher frequency of aberrant particles. Similar
mechanisms could help regulate the flow and incorporation of cellular
protein subunits into nuclear structures, such as transcription
complexes (6) and spliceosomes (46).
 |
ACKNOWLEDGMENTS |
We thank Lisa Cimakasky for help in constructing the
-Gal
constructs during a research rotation in the laboratory, Kendra Clopper
Plafker for excellent technical assistance, and Pamela Harvey and
Michael McElwaine for patience and diligence in printing the
photomicrographs.
S.M.P. was a student in the Pharmacology and Molecular Sciences
training program and was supported by USPHS grant GM07626. This work
was aided by USPHS research grants AI13718 and AI32957.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Virology
Laboratories, Department of Pharmacology and Molecular Sciences, Johns
Hopkins University School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-8680. Fax: (410) 955-3023. E-mail:
Wade_Gibson{at}qmail.bs.jhu.edu.
Present address: Department of Internal Medicine, University of
Virginia, Charlottesville, Va.
 |
REFERENCES |
| 1.
|
Albrecht, J.-C.,
J. Nicholas,
D. Biller,
K. R. Cameron,
B. Biesinger,
C. Newman,
S. Wettmann,
M. A. Craxton,
H. Coleman,
B. Fleckenstein, and R. W. Honess.
1992.
Primary structure of the herpesvirus saimiri genome.
J. Virol.
66:5047-5058[Abstract/Free Full Text].
|
| 2.
|
Baer, R.,
A. T. Bankier,
M. D. Biggin,
P. L. Deininger,
P. J. Farrell,
T. J. Gibson,
G. Hatfull,
G. S. Hudson,
S. C. Satchwell,
C. Sequin,
P. S. Tufnell, and B. G. Barrell.
1984.
DNA sequence and expression of the B95-8 Epstein-Barr virus genome.
Nature (London)
310:207-211[Medline].
|
| 3.
|
Baxter, M. K., and W. Gibson.
1997.
The putative human cytomegalovirus triplex proteins, minor capsid protein (mCP) and mCP-binding protein (mC-BP), form a heterotrimeric complex that localizes to the cell nucleus in the absence of other viral proteins.
In
Presented at the 22nd International Herpesvirus Workshop, La Jolla, Calif.
|
| 3a.
| Baxter, M. K., and W. Gibson. Unpublished
data.
|
| 4.
|
Boehm, U.,
M. Heinlein,
U. Behrens, and R. Kunze.
1995.
One of three nuclear localization signals of maize Activator (Ac) transposase overlaps the DNA-binding domain.
Plant J.
7:441-451[Medline].
|
| 5.
|
Bonner, W. M.
1975.
Protein migration into nuclei.
J. Cell Biol.
64:421-430[Abstract/Free Full Text].
|
| 6.
|
Boulikas, T.
1997.
Nuclear import of DNA repair proteins.
Anticancer Res.
17:843-864[Medline].
|
| 7.
|
Camacho, A., and E. Tabares.
1996.
Characterization of the genes, including that encoding the viral proteinase, contained in BamHI restriction fragment 9 of the pseudorabies virus genome.
J. Gen. Virol.
77(Pt.8):1865-1874[Abstract/Free Full Text].
|
| 8.
|
Cepko, C. L., and P. A. Sharp.
1983.
Analysis of Ad5 hexon and 100K temperature sensitive mutants using conformation-specific monoclonal antibodies.
Virology
129:137-154[Medline].
|
| 9.
|
Chee, M. S.,
A. T. Bankier,
S. Beck,
R. Bohni,
C. M. Brown,
R. Cerny,
T. Horsnell,
C. A. Hutchison,
T. Kouzarides,
J. A. Martignetti,
E. Preddie,
S. C. Satchwell,
P. Tomlinson,
K. M. Weston, and B. G. Barrell.
1990.
Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169.
Curr. Top. Microbiol. Immun.
154:125-169[Medline].
|
| 10.
|
Dang, C. V., and W. M. F. Lee.
1988.
Identification of the human c-myc protein nuclear translocation signal.
Mol. Cell. Biol.
8:4048-4054[Abstract/Free Full Text].
|
| 11.
|
Davison, A. J.
1992.
Channel catfish virus: a new type of herpesvirus.
Virology
186:9-14[Medline].
|
| 12.
|
Davison, A. J., and J. E. Scott.
1986.
The complete DNA sequence of varicella-zoster virus.
J. Gen. Virol.
67:1759-1816[Abstract/Free Full Text].
|
| 13.
|
Delos, S. E.,
L. Montroll,
R. B. Moreland, and R. L. Garcea.
1993.
Expression of the polyomavirus VP2 and VP3 proteins in insect cells: coexpression with the major capsid protein VP1 alters VP2/VP3 subcellular localization.
Virology
194:393-398[Medline].
|
| 14.
|
Desai, P., and S. Person.
1996.
Molecular interactions between the HSV-1 capsid proteins as measured by the yeast two-hybrid system.
Virology
220:516-521[Medline].
|
| 15.
|
Dingwall, C.,
S. V. Sharnick, and R. A. Laskey.
1982.
A polypeptide domain that specifies migration of nucleoplasmin into the nucleus.
Cell
30:449-458[Medline].
|
| 16.
|
Dworetzky, S. I.,
R. E. Lanford, and C. M. Feldherr.
1988.
The effects of variations in the number and sequence of targeting signals on nuclear uptake.
J. Cell Biol.
107:1279-1287[Abstract/Free Full Text].
|
| 17.
|
Ensser, A.,
R. Pflanz, and B. Fleckenstein.
1997.
Primary structure of the alcelaphine herpesvirus 1 genome.
J. Virol.
71:6517-6525[Abstract].
|
| 18.
|
Forstova, F.,
N. Krauzewicz,
S. Wallace,
A. J. Street,
S. M. Dilworth,
S. Beard, and B. E. Griffin.
1993.
Cooperation of structural proteins during late events in the life cycle of polyomavirus.
J. Virol.
67:1405-1413[Abstract/Free Full Text].
|
| 19.
|
Gao, M.,
L. Matusick-Kuman,
W. Hurlburt,
S. F. DiTusa,
W. W. Newcomb,
J. C. Brown,
P. J. McCann,
I. Deckman, and R. J. Colonno.
1994.
The protease of herpes simplex virus type 1 is essential for functional capsid formation and viral growth.
J. Virol.
68:3702-3712[Abstract/Free Full Text].
|
| 20.
|
Garcia-Bustos, J.,
J. Heitman, and M. N. Hall.
1991.
Nuclear protein localization.
Biochim. Biophys. Acta
1071:83-101[Medline].
|
| 21.
|
Gibson, W.
1981.
Structural and nonstructural proteins of strain Colburn cytomegalovirus.
Virology
111:516-537[Medline].
|
| 22.
|
Gibson, W.
1996.
Structure and assembly of the virion.
Intervirology
39:389-400[Medline].
|
| 23.
|
Gibson, W.,
A. Marcy,
J. C. Comolli, and J. Lee.
1990.
Identification of precursor to cytomegalovirus capsid assembly protein and evidence that processing results in loss of its carboxy-terminal end.
J. Virol.
64:1241-1249[Abstract/Free Full Text].
|
| 24.
|
Gibson, W., and B. Roizman.
1974.
Proteins specified by herpes simplex virus. X. Staining and radiolabeling properties of B capsid and virion proteins in polyacrylamide gels.
J. Virol.
13:155-165[Abstract/Free Full Text].
|
| 25.
|
Gilmore, T. D., and H. M. Temin.
1988.
v-rel oncoproteins in the nucleus and in the cytoplasm transform chicken spleen cells.
J. Virol.
62:703-714[Abstract/Free Full Text].
|
| 26.
|
Gompels, U. A.,
J. Nicholas,
G. Lawrence,
M. Jones,
B. J. Thomson,
M. E. D. Martin,
S. Efstathiou,
M. Craxton, and H. A. Macaulay.
1995.
The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution.
Virology
209:29-51[Medline].
|
| 27.
|
Griffin, A. M.
1990.
The complete sequence of the capsid p40 gene from infectious laryngotracheitis virus.
Nucleic Acids Res.
18:3664[Free Full Text].
|
| 28.
|
Haanes, E. J.,
D. R. Thomsen,
S. Martin,
F. L. Homa, and D. E. Lowery.
1995.
Bovine herpesvirus 1 maturational proteinase and scaffold proteins can substitute for the homologous herpes simplex virus type 1 proteins in the formation of hybrid type B capsids.
J. Virol.
69:7375-7379[Abstract].
|
| 29.
|
Hall, M. R. T., and W. Gibson.
1996.
Cytomegalovirus assemblin: the amino and carboxyl domains of the proteinase form active enzyme when separately cloned and coexpressed in eukaryotic cells.
J. Virol.
70:5395-5404[Abstract/Free Full Text].
|
| 30.
|
Holwerda, B. C.,
A. J. Wittwer,
K. L. Duffin,
C. Smith,
M. V. Toth,
L. S. Carr,
R. C. Wiegand, and M. L. Bryant.
1994.
Activity of two-chain recombinant human cytomegalovirus protease.
J. Biol. Chem.
269:25911-25915[Abstract/Free Full Text].
|
| 31.
|
Hong, Z.,
M. Beaudet-Miller,
J. Burkin,
R. Zhang, and A. D. Kwong.
1996.
Identification of a minimal hydrophobic domain in the herpes simplex virus type 1 scaffolding protein which is required for interaction with the major capsid protein.
J. Virol.
70:533-540[Abstract].
|
| 32.
|
Irmiere, A., and W. Gibson.
1983.
Isolation and characterization of a noninfectious virion-like particle released from cells infected with human strains of cytomegalovirus.
Virology
130:118-133[Medline].
|
| 33.
|
Kalderon, D.,
W. D. Richardson, and A. F. Markham.
1984.
Sequence requirements for nuclear location of simian virus 40 large-Ta antigen.
Nature
311:33-38[Medline].
|
| 34.
|
Kalderon, D.,
B. L. Roberts,
W. D. Richardson, and A. E. Smith.
1984.
A short amino acid sequence able to specify nuclear location.
Cell
39:499-509[Medline].
|
| 35.
|
Kasamatsu, H., and A. Nehorayan.
1979.
Vp1 affects intracellular localization of Vp3 polypeptide during simian virus 40 infection.
Proc. Natl. Acad. Sci. USA
76:2808-2812[Abstract/Free Full Text].
|
| 36.
|
Kennard, J.,
F. J. Rixon,
I. S. McDougall,
J. D. Tatman, and V. G. Preston.
1995.
The 25 amino acid residues at the carboxy terminus of the herpes simplex virus type 1 UL26.5 protein are required for the formation of the capsid shell around the scaffold.
J. Gen. Virol.
76:1611-1621[Abstract/Free Full Text].
|
| 37.
|
Knauf, J. A.,
S. H. Pendergrass,
B. L. Marrone,
G. F. Strmiste,
M. A. MacInne, and M. S. Park.
1996.
Multiple nuclear localization signals in XPG nuclease.
Mutat. Res.
363:67-75[Medline].
|
| 38.
|
Liu, F., and B. Roizman.
1991.
The herpes simplex virus 1 gene encoding a protease also contains within its coding domain the gene encoding the more abundant substrate.
J. Virol.
65:5149-5156[Abstract/Free Full Text].
|
| 39.
|
Loutsch, J. M.,
N. J. Galvin,
M. L. Bryant, and B. C. Holwerda.
1994.
Cloning and sequence analysis of murine cytomegalovirus protease and capsid assembly protein genes.
Biochem. Biophys. Res. Commun.
203:472-478[Medline].
|
| 40.
|
McGeoch, D. J.,
M. A. Dalrymple,
A. J. Davison,
A. Dolan,
M. C. Frame,
D. McNab,
L. J. Perry,
J. E. Scott, and P. Taylor.
1988.
The complete sequence of the long unique region in the genome of herpes simplex virus type 1.
J. Gen. Virol.
69:1531-1574[Abstract/Free Full Text].
|
| 41.
|
Nicholas, J.
1996.
Determination and analysis of the complete nucleotide sequence of human herpesvirus 7.
J. Virol.
70:5975-5989[Abstract].
|
| 42.
|
Nicholson, P.,
C. Addison,
A. M. Cross,
J. Kennard,
V. G. Preston, and F. J. Rixon.
1994.
Localization of the herpes simplex virus type 1 major capsid protein VP5 to the cell nucleus requires the abundant scaffolding protein VP22a.
J. Gen. Virol.
75:1091-1099[Abstract/Free Full Text].
|
| 43.
|
Paine, P. L., and C. M. Feldherr.
1972.
Nucleocytoplasmic exchange of macromolecules.
Exp. Cell Res.
74:81-98[Medline].
|
| 44.
|
Pelletier, A.,
F. Do,
J. J. Brisebois,
L. Legace, and M. G. Cordingley.
1997.
Self-association of herpes simplex virus type 1 ICP35 is via coiled-coil interactions and promotes stable interaction with the major capsid protein.
J. Virol.
71:5197-5208[Abstract].
|
| 44a.
| Plafker, K. C., M.-E. Harmon, and W. Gibson. Unpublished data.
|
| 44b.
| Plafker, S. M., and W. Gibson. Unpublished
data.
|
| 45.
|
Preston, V. G.,
J. A. Coates, and F. J. Rixon.
1983.
Identification and characterization of a herpes simplex virus gene product required for encapsidation of virus DNA.
J. Virol.
45:1056-1064[Abstract/Free Full Text].
|
| 46.
|
Raker, V. A.,
G. Plessel, and R. Luhrmann.
1996.
The snRNP core assembly pathway: identification of stable core protein heteromeric complexes and an snRNP subcore particle in vitro.
EMBO J.
15:2256-2269[Medline].
|
| 47.
|
Rixon, F. J.,
C. Addison,
A. McGregor,
S. L. Macnab,
P. Nicholson,
V. G. Preston, and J. D. Tatman.
1996.
Multiple interactions control the intracellular localization of the herpes simplex virus type 1 capsid proteins.
J. Gen. Virol.
77:2251-2260[Abstract/Free Full Text].
|
| 48.
|
Roberts, B. L.,
W. D. Richardson, and A. E. Smith.
1987.
The effect of protein context on nuclear location signal function.
Cell
50:465-475[Medline].
|
| 49.
|
Roby, C., and W. Gibson.
1986.
Characterization of phosphoproteins and protein kinase activity of virions, noninfectious enveloped particles, and dense bodies of human cytomegalovirus.
J. Virol.
59:714-727[Abstract/Free Full Text].
|
| 50.
|
Roizman, B.,
L. E. Carmichael,
F. Deinhardt,
G. de-The,
A. J. Nahmias,
W. Plowright,
F. Rapp,
P. Sheldrick,
M. Takahashi, and K. Wolf.
1981.
Herpesviridae. Definition, provisional nomenclature and taxonomy.
Intervirology
16:201-217[Medline].
|
| 51.
|
Russo, J. J.,
R. A. Bohenzky,
M.-C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 52.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 53.
|
Schenk, P.,
A. S. Woods, and W. Gibson.
1991.
The 45-kDa protein of cytomegalovirus (Colburn) B-capsids is an amino-terminal extension form of the assembly protein.
J. Virol.
65:1525-1529[Abstract/Free Full Text].
|
| 54.
|
Steffy, K. R.,
S. Schoen, and C. M. Chen.
1995.
Nucleotide sequence of the herpes simplex virus type 2 gene encoding the protease and capsid protein ICP35.
J. Gen. Virol.
76:1069-1072[Abstract/Free Full Text].
|
| 55.
|
Szebeni, A.,
B. Mehrotra,
A. Baumann,
S. A. Adam,
P. T. Wingfield, and M. O. J. Olson.
1997.
Nucleolar protein B23 stimulates nuclear import of the HIV-1 Rev protein and NLS-conjugated albumin.
Biochemistry
36:3941-3949[Medline].
|
| 56.
|
Telford, E. A.,
M. S. Watson,
H. C. Aird,
J. Perry, and A. J. Davison.
1995.
The DNA sequence of equine herpesvirus type 2.
J. Mol. Biol.
249:520-528[Medline].
|
| 57.
|
Telford, E. A. R.,
M. S. Watson,
K. McBride, and A. J. Davison.
1992.
The DNA sequence of equine herpes 1.
Virology
189:304-316[Medline].
|
| 58.
|
Vandromme, M.,
J.-C. Cavadore,
A. Bonnieu,
A. Froeschle,
N. Lamb, and A. Fernandez.
1995.
Two nuclear localization signals present in the basic-helix 1 domains of MyoD promote its active nuclear translocation and can function independently.
Proc. Natl. Acad. Sci. USA
92:4646-4650[Abstract/Free Full Text].
|
| 59.
|
Virgin, H. W. I.,
P. Latreille,
P. Wamsley,
K. Hallsworth,
K. E. Weck,
A. J. Dal Canto, and S. H. Speck.
1997.
Complete sequence and genomic analysis of murine gammaherpesvirus 68.
J. Virol.
71:5894-5904[Abstract].
|
| 60.
|
Welch, A. R.,
L. M. McNally, and W. Gibson.
1991.
Cytomegalovirus assembly protein nested gene family: four 3'-coterminal transcripts encode four in-frame, overlapping proteins.
J. Virol.
65:4091-4100[Abstract/Free Full Text].
|
| 61.
|
Welch, A. R.,
L. M. McNally,
M. R. T. Hall, and W. Gibson.
1993.
Herpesvirus proteinase: site-directed mutagenesis used to study maturational, release, and inactivation cleavage sites of precursor and to identify a possible catalytic site serine and histidine.
J. Virol.
67:7360-7372[Abstract/Free Full Text].
|
| 62.
|
Welch, A. R.,
A. S. Woods,
L. M. McNally,
R. J. Cotter, and W. Gibson.
1991.
A herpesvirus maturational proteinase, assemblin: identification of its gene, putative active site domain, and cleavage site.
Proc. Natl. Acad. Sci. USA
88:10792-10796[Abstract/Free Full Text].
|
| 63.
|
Wood, L. J.,
M. K. Baxter,
S. M. Plafker, and W. Gibson.
1997.
Human cytomegalovirus capsid assembly protein precursor (pUL80.5) interacts with itself and with the major capsid protein (pUL86) through two different domains.
J. Virol.
71:179-190[Abstract].
|
Journal of Virology, October 1998, p. 7722-7732, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Henson, B. W., Perkins, E. M., Cothran, J. E., Desai, P.
(2009). Self-Assembly of Epstein-Barr Virus Capsids. J. Virol.
83: 3877-3890
[Abstract]
[Full Text]
-
Nguyen, N. L., Loveland, A. N., Gibson, W.
(2008). Nuclear Localization Sequences in Cytomegalovirus Capsid Assembly Proteins (UL80 Proteins) Are Required for Virus Production: Inactivating NLS1, NLS2, or Both Affects Replication to Strikingly Different Extents. J. Virol.
82: 5381-5389
[Abstract]
[Full Text]
-
Brignole, E. J., Gibson, W.
(2007). Enzymatic Activities of Human Cytomegalovirus Maturational Protease Assemblin and Its Precursor (pPR, pUL80a): Maximal Activity of pPR Requires Self-Interaction through Its Scaffolding Domain. J. Virol.
81: 4091-4103
[Abstract]
[Full Text]
-
Loveland, A. N., Nguyen, N. L., Brignole, E. J., Gibson, W.
(2007). The Amino-Conserved Domain of Human Cytomegalovirus UL80a Proteins Is Required for Key Interactions during Early Stages of Capsid Formation and Virus Production. J. Virol.
81: 620-628
[Abstract]
[Full Text]
-
Casaday, R. J., Bailey, J. R., Kalb, S. R., Brignole, E. J., Loveland, A. N., Cotter, R. J., Gibson, W.
(2004). Assembly Protein Precursor (pUL80.5 Homolog) of Simian Cytomegalovirus Is Phosphorylated at a Glycogen Synthase Kinase 3 Site and Its Downstream "Priming" Site: Phosphorylation Affects Interactions of Protein with Itself and with Major Capsid Protein. J. Virol.
78: 13501-13511
[Abstract]
[Full Text]
-
Lai, L., Britt, W. J.
(2003). The Interaction between the Major Capsid Protein and the Smallest Capsid Protein of Human Cytomegalovirus Is Dependent on Two Linear Sequences in the Smallest Capsid Protein. J. Virol.
77: 2730-2735
[Abstract]
[Full Text]
-
Chan, C.-K., Brignole, E. J., Gibson, W.
(2002). Cytomegalovirus Assemblin (pUL80a): Cleavage at Internal Site Not Essential for Virus Growth; Proteinase Absent from Virions. J. Virol.
76: 8667-8674
[Abstract]
[Full Text]
-
Zhou, S., Hayward, S. D.
(2001). Nuclear Localization of CBF1 Is Regulated by Interactions with the SMRT Corepressor Complex. Mol. Cell. Biol.
21: 6222-6232
[Abstract]
[Full Text]
-
Giesen, K., Radsak, K., Bogner, E.
(2000). The potential terminase subunit of human cytomegalovirus, pUL56, is translocated into the nucleus by its own nuclear localization signal and interacts with importin {alpha}. J. Gen. Virol.
81: 2231-2244
[Abstract]
[Full Text]
-
Pasion, S. G., Forsburg, S. L.
(1999). Nuclear Localization of Schizosaccharomyces pombe Mcm2/Cdc19p Requires MCM Complex Assembly. Mol. Biol. Cell
10: 4043-4057
[Abstract]
[Full Text]
-
Plafker, S. M., Woods, A. S., Gibson, W.
(1999). Phosphorylation of Simian Cytomegalovirus Assembly Protein Precursor (pAPNG.5) and Proteinase Precursor (pAPNG1): Multiple Attachment Sites Identified, Including Two Adjacent Serines in a Casein Kinase II Consensus Sequence. J. Virol.
73: 9053-9062
[Abstract]
[Full Text]