Previous Article | Next Article 
J Virol, January 1998, p. 512-519, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Spontaneous Mutations in the env Gene of the Human
Immunodeficiency Virus Type 1 NDK Isolate Are Associated with a
CD4-Independent Entry Phenotype
Julie
Dumonceaux,1
Sébastien
Nisole,1,2
Chantal
Chanel,1
Laurence
Quivet,1
Ali
Amara,3
Fran
ise
Baleux,4
Pascale
Briand,1 and
Uriel
Hazan1,5,*
INSERM Unité 380 Laboratoire de
Pathologie et Génétique Expérimentales, Institut
Cochin de Génétique Moléculaire, 75014 Paris,1
Unité de Virologie et Immunologie
Cellulaire, URA 1157,2
Unité d'Immunologie
Virale3
Unité de Chimie
Organique,4 Institut Pasteur, 75015 Paris, and
Université Paris 7 Denis Diderot, UFR de Biochimie,
75005 Paris,5 France
Received 12 June 1997/Accepted 29 September 1997
 |
ABSTRACT |
Human immunodeficiency virus type 1 (HIV-1) entry into target cells
is a multistep process initiated by envelope protein gp120 binding to
cell surface CD4. The conformational changes induced by this
interaction likely favor a second-step interaction between gp120 and a
coreceptor such as CXCR4 or CCR5. Here, we report a spontaneous and
stable CD4-independent entry phenotype for the HIV-1 NDK isolate. This
mutant strain, which emerged from a population of chronically infected
CD4-positive CEM cells, can replicate in CD4-negative human cell lines.
The presence of CXCR4 alone renders cells susceptible to infection by
the mutant NDK, and infection can be blocked by the CXCR4 natural
ligand SDF-1. Furthermore, we have correlated the CD4-independent
phenotype with seven mutations in the C2 and C3 regions and the V3
loop. We propose that the mutant gp120 spontaneously acquires a
conformation allowing it to interact directly with CXCR4. This virus
provides us with a powerful tool to study directly gp120-CXCR4
interactions.
 |
INTRODUCTION |
Human immunodeficiency virus (HIV)
entry into target cells is mediated by CD4 and a coreceptor belonging
to the chemokine receptor family (1, 10, 11, 14, 18, 22).
HIV type 1 strains are able to infect macrophages and CD4 lymphocytes
or T-cell lines, reflecting differences in coreceptor usage
(8). Macrophage-tropic isolates use the CC chemokine
receptor CCR5 as a coreceptor, whereas T-cell line-adapted (TCLA)
isolates use the CXC chemokine receptor CXCR4 as a coreceptor (1,
11, 14, 18). Dual-tropic viruses constitute the majority of
primary isolates and can use both coreceptors. Whatever the coreceptor specificity of an HIV isolate may be, an interaction with CD4 is always
the first step in a chain of events leading to fusion of the viral
envelope with the plasma membrane. Envelope glycoprotein interactions
with CD4 and the coreceptor are probably aimed at bringing the viral
envelope membrane close to the plasma membrane, allowing transmembrane
protein gp41 to initiate the fusion process.
gp120 binds directly to CD4 (23, 28), inducing
conformational changes in the envelope glycoproteins thought to expose a binding domain for the coreceptors (25, 31). A direct
interaction between gp120 and CCR5 or CXCR4 can be detected only in the
presence of soluble CD4 (12a). Recent data suggest an
important role of the V3 loop in coreceptor binding (36,
37), though no direct interaction with the coreceptors has ever
been formally demonstrated. This region of gp120 is a major determinant
of viral tropism, since a portion of the V3 loop from a
macrophage-tropic isolate is sufficient to confer macrophage tropism on
a TCLA isolate, without affecting binding of gp120 to CD4 (3, 21,
27, 32, 33).
We report the first isolation of an HIV-1 strain that no longer
requires the presence of CD4 to enter target cells. This spontaneous and stable entry phenotype occurred after long-term culture of HIV-1
strain NDK in CEM cells (15). We have obtained molecular clones of the mutant virus and show that it is capable of infecting different CD4-negative human cells after a direct interaction with
CXCR4. We were able to correlate this new phenotype with mutations in
critical regions of the env gene, including the V3 loop.
CD4-independent infection has so far been reported for only one HIV-2
isolate and has been correlated with mutations dispersed throughout the
env gene (5, 16, 30).
 |
MATERIALS AND METHODS |
Cells and viruses.
Nonadherent cells were grown in RPMI 1640 medium (Gibco-BRL) supplemented with 10% fetal calf serum,
antibiotics, and glutamine. CD4-positive human lymphoid T-cell lines
CEM and H9 were gifts from J.-L. Virelizier (Institut Pasteur, Paris,
France). The human T-cell leukemia virus type 3b (HTLV3b) isolate has
been described previously (29) and was cultured on H9 cells.
The NDK isolate has been described elsewhere (15) and was
maintained in CEM cells. It was a gift from F. Barre-Sinoussi (Institut
Pasteur). NDK isolate mutants m5 and m7 have been obtained after
long-term culture followed by limiting-dilution cloning of the
chronically infected CEM cell line. Infections were performed by
incubation of target cells with 4 ml of filtered infectious
supernatants for 4 h. Virus supernatants were generally titrated
the same day on HeLa CD4LacZ indicator cells. All adherent
cell lines were grown in Dulbecco modified Eagle medium (Gibco-BRL)
supplemented with 10% fetal calf serum, antibiotics, and
glutamine. HeLaLTRLacZ, HeLaCD4LTRLacZ,
Cos7LTRLacZ, and Cos7CD4LTRLacZ indicator cells have been described previously (13) and were a gift from M. Alizon (Institut Cochin de Génétique Moléculaire
[ICGM], Paris, France). CaCo2 and HT29 cells were obtained from F. Russo-Marie (ICGM), and the Wish, SW480, and U373MG cell lines were
obtained from J.-L. Virelizier (Institut Pasteur). Stable
cotransfections were performed by the calcium phosphate coprecipitation
technique. Stable clones or populations were functionally tested by
coculture experiments. CCR5 expression was monitored by both
reverse transcription-PCR and transient transfection of a CD4
expression vector followed by cocultures with cells expressing
macrophage-tropic isolate Env proteins.
Cell fusion assays.
SDF-1 (stroma cell-derived factor 1) was
obtained by a procedure previously described (6). RANTES was
purchased from R&D Systems. Syncytium formation assays were performed
with adherent or nonadherent HIV-1-infected cells and adherent
indicator target cells. Indicator target cells contained a transiently
or stably expressed long terminal repeat (LTR)-luciferase or stably
expressed LTR-lacZ reporter gene cassette. Cell ratios were
usually 1:1 for adherent cell cocultures and 1:2 to 1:5 for
adherent-nonadherent cocultures. Depending on cell fusion efficiency,
samples were analyzed between 8 and 16 h later. Too-efficient
fusions were analyzed visually by May-Grumwald-Giemsa staining and
photographed by using a phase-contrast microscope under ×40 or ×80
magnification. Depending on the indicator cells used, analyses using
two indicator reporter gene systems (lacZ or luciferase
gene) were performed. Reporter gene assays allowed quantitative or in
situ analysis. For in situ analysis using
-galactosidase activity,
cells were fixed in 0.5% glutaraldehyde, and
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
assays were performed for 4 h at 37°C or overnight at 4°C,
depending on the experiments, as previously described (13). Blue-stained syncytia were scored under ×40 binocular magnification. Quantitative chlorophenol red-
-D-galactopyranoside
(CPRG) (Boehringer Mannheim) assays were done after recovery of cell
extracts following incubation in a lysis buffer (60 mM
Na2HPO4, 40 mM NaH2PO4,
10 mM KCl, 10 mM MgSO4, 2.5 mM EDTA, 50 mM
-mercaptoethanol, 0.125% Nonidet P-40). The cell extracts were then
incubated in a reaction buffer (0.9 M phosphate buffer [pH 7.4], 9 mM
MgCl2, 11 mM
-mercaptoethanol, 7 mM CPRG) for 90 min.
The resulting activities were measured with an LP400 (Becton Dickinson)
plate reader as optical density at 570 nm. Experiments were performed
in triplicate. Luciferase tests were performed on a LB9501 luminometer
(EGG Berthold) as previously described (34).
Constructs.
The NDK proviral genomic clone was a gift from
B. Spire (35). The CXCR4 expression vector was a gift from
B. Moser (University of Bern, Bern, Switzerland) (24), and
the CCR5 expression vector was obtained from J. Moore and T. Dragic (Aaron Diamond AIDS Research Center, New York, N.Y.)
(14). The pLTR-Luc plasmid used in transfection experiments
has been described elsewhere (34). The env
cassette expression vector contained a PCR-amplified, blunted HIV-1 NDK LTR cloned in the blunted SacI site of pBSKS+
(Stratagene). The primers used were 5'8602
(5'TAATTTGGTCAAAGAAAAGACAAGAG3') and 3'313
(5'ATCTCTCTCCTTCTAGCCTC-CGC3'), and the 877-bp amplified fragment contained the whole promoter, the trans-activating
region (TAR), and the common splice donor (SD) site of the virus. The XhoI-BglII (blunted) fragment from the poly(A) of
the murine PGK gene was inserted in the
XhoI-Asp718 (blunted) sites of the polylinker. env regions were PCR amplified from genomic DNA from
infected cells by using the primers 5'5236
(5'AAACTTATGGGGATACCTGGGCAGG3') and NDK6
(5'ATTGCCCCATGTTTTTCCAGG3'). The resulting 3,193-bp fragment was digested with EcoRI and XhoI enzymes and
cloned in the same sites of the polylinker of the expression vector.
The ligated fragment contained env, tat,
rev, and vpu gene open reading frames, and the
proteins are expressed after alternative splices between the common SD
site from the promoter region and gene-specific acceptor sites.
Chimeric constructs between derived and nonderived cloned
env genes were made by using unique restriction sites in the
env gene. EcoRV and HindIII sites
were used for amino acids located in the V3-C3 region, EcoRI
and HindIII sites were used for amino acids situated in
the C2, V3, and C3 regions, and EcoRI and EcoRV
sites were used for the C2 region. Regions were exchanged as indicated
below (see Fig. 7).
Sequence analysis.
Relevant mutations of env
genes were analyzed either by direct sequencing of PCR-amplified
fragments or by sequencing after cloning in the expression vector. In
the latter case, only transfected vectors showing expected cell fusion
tropism were sequenced. The sequencing method used the ABI-Prism kit
(Perkin-Elmer), allowing PCR sequencing with fluorescent nucleotides
and automated gel reading. Results were directly computerized for
performance of sequence analyses and comparisons. The sequences were
established twice in both senses by the use of the following
oligonucleotide primers dispatched approximately every 200 to 300 bases: NDK1 (5'AATAGC-AATAGTTGTGTGGACC3'), NDK2
(5'TTGTAGCTACCTGTTGTAAAGC3'), NDK3
(5'AAGCACATTGTAAAATTAGCA3'), NDK4
(5'AAATAATCCGTTCACCAATCG3'), NDK5
(5'TCACTTCTGTCATTTCAGACC3'), NDK6
(5'ATTGCCCCATGTTTTTGGAGG3'), 5'5236
(5'AAACTTATGGGGATACCTGGGCAGG3'), 5'5979
(5'TACCCACGGACCCCAACCC3'), 5'6379
(5'TTTCCAATTCTATTTCTTGTGGG3'), 5'7058
(5'AAATGTTCATCAAATATTACAGGG3'), 5'7573
(5'TAATAGATCTCTAGATGAGATTTGG3'), 5'8069
(5'ATTGTGGAACTTCTGGGACGC3'), 3'5995
(5'TTTCCAATTCTATTTCTTGTGGG3'), 3'6377
(5'AAAAATGTATGGGAATTGG3'), 3'7155
(5'ATAATTCACTTCTCCAATTGTCCC3'), 3'7617
(5'AATTGTCAATTTCTCTTTCCC3'), and 3'8379
(5'ATACTGCTCCTACCCCATCTGC3'). The relevance of mutations was
ensured by use of the PCR method to determine consensus sequences.
 |
RESULTS |
Characterization of a mutant NDK tropism for CD4-negative
cells.
Cocultures of LTR-lacZ indicator cells and CEM
cells chronically infected with the HIV-1-mutated NDK isolate revealed
syncytium formation with both HeLaCD4 and HeLa cells (Fig.
1A, panels a and b). By contrast, H9
cells infected with the HIV-1 HTLV3b isolate efficiently formed
syncytia only with HeLaCD4 indicator cells (Fig. 1A, panel c) and, as
expected, did not fuse with HeLa cells (Fig. 1A, panel d). Usually, 10- to 15-fold-more syncytia were observed when the indicator cells
expressed the CD4 antigen, showing that although it is no longer
necessary, CD4 optimizes viral entry of mutant NDK (mNDK). The infected
CEM population therefore contains a viral population which has
undergone a phenotypic switch of its cell tropism. We refer to this
uncloned population as CEMmNDK. Different human
adherent cell lines were analyzed for their ability to allow
CD4-independent mNDK entry. We transiently transfected an
LTR-luciferase vector into different cell lines and cocultured them
with CEMmNDK. Detection of luciferase activity revealed
that CD4-negative cell lines such as HeLa, Wish, and SW480 were able to
fuse with CEMmNDK cells, whereas human U373MG, CaCo2, and
HT29 cells, which do not express CXCR4 (data not shown), were not (Fig. 1B). This also demonstrated that galactosylceramide, expressed on
U373MG, CaCo2, and HT29 cells, was not involved in this phenomenon (9, 17, 19).

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 1.
Coculture experiments with HIV-1-infected cells and
different human target cells. (A) CD4-positive (panels a and c) or
CD4-negative (panels b and d). HeLa indicator cells stably expressing
an HIV LTR-lacZ gene were cocultured with either
CEMMNDK cells (panels a and b) or HTLV3b-infected H9 cells
(panels c and d). An in situ -galactosidase test was performed after
16 h of culture to score and analyze specific fusion events. Cells
were photographed under ×40 magnification. (B) Different human cell
lines were transiently transfected with an HIV-1 LTR-luciferase gene
and trypsinized 16 h thereafter to be used for cocultures with
different CEM cell lines infected with either NDK or mNDK virus. The
experiment whose results are presented is representative of at least
three independent manipulations. Fold induction (indicated above the
bars) was standardized in comparison to luciferase activities obtained
for cocultures with the nonderived virus.
|
|
Subcloning of mutant viruses.
The CEMmNDK
infected-cell population was cloned by limiting dilution. Sixty-four
independent clones were analyzed for their fusion ability by coculture
with indicator cells (Table 1), and we
used two different indicator gene systems (luciferase [Fig. 2A] and lacZ [Fig. 2B and
C]). Only eight clones exhibited a CD4-independent tropism. The others
were either nonfusogenic or strictly CD4 dependent (Table 1). We
selected three clones (CEM clones 15, 27, and 29) for further analysis.
The two reporter systems strictly correlated and clearly demonstrated
that CEM clone 15 presented a strict CD4-dependent tropism, whereas CEM
clone 29 presented a CD4-independent cell tropism (Fig. 2). Results
illustrated in Table 1 strongly suggest that a progressive phenotype
shift occurred, since intermediate fusion phenotypes were characterized
in the infected-cell population. Fusion efficiencies varied from one
clone to another. Only 12.5% of the cellular clones were CD4
independent (Table 1). This may signify that the CD4-independent
tropism represents a dominant phenotype. Our results clearly
demonstrate that the infected CEM population contains phenotypically
heterogeneous viruses.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Fusion phenotype of infected CEM cell clones. (A) An HIV
LTR-luciferase plasmid was transiently transfected in HeLa cells, and
coculture experiments with CEM clone (Cl.) 15 or 29 were then
performed. Fold induction (indicated above the bars) was standardized
in comparison to luciferase (Luc.) activities obtained for cocultures
with CEM clone 15. (B) Coculture experiments between CD4-negative
indicator HeLa lacZ cells were performed with CEM cell
clones 15 and 29. Blue-stained syncytia were scored, and fold induction
was standardized in comparison to the number of syncytia scored for
cocultures with CEM clone 15. (C) Coculture experiments between
CD4-negative (panels b and d) or CD4-positive (panels a and c)
indicator HeLa lacZ cells were performed with CEM clones 15 (panels a and b) and 29 (panels c and d). An in situ -galactosidase
test was performed after 16 h of coculture to analyze and
photograph specific fusion events (magnification, ×40).
|
|
Stability of the phenotype shift.
We infected SW480 and HeLa
cells with filtered supernatant from the CEMmNDK
infected-cell population. Chronically infected HeLamNDK and
SW480mNDK cell populations were obtained, filtered supernatants from which were used to infect the CD4-positive human T-cell line H9. Chronically infected cell populations were designated H9H and H9S, respectively (Fig.
3A). The chronically infected populations
were cocultured with human LTR-lacZ indicator
CD4+ or CD4
HeLa cells (Fig. 3B, panels a, c,
e, and g, and B, panels b, d, f, and h, respectively). In all cases,
the same entry phenotype as for the original mNDK-infected CEM cell
population was observed (Fig. 3B). Infection of the CD4+
human T-cell line H9 revealed no reversion of the fusion phenotype.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
Experimental strategy followed to analyze the stability
of the new entry phenotype and to localize mutations of the derived
virus. (A) CEMmNDK infected-cell supernatants were used to
infect either SW480 or HeLa cells. Supernatants of the resulting
chronically infected cell lines were used to infect the H9 CD4-positive
T-lymphocytic cell line. Chronically infected cell lines
H9H and H9S were obtained for further syncytium
formation analysis. Cellular clones were also obtained as indicated.
Fusion phenotype analysis of different infected-cell populations,
molecular cloning, and sequencing of the env gene were
performed at each step. (B) Coculture experiments between CD4-negative
(panels b, d, f, and h) or CD4-positive (panels a, c, e, and g)
indicator HeLa lacZ cells were performed with
HeLamNDK (panels a and b), SW480mNDK (panels c
and d), H9H (panels e and f), and H9S (panels g
and h) cells. An in situ -galactosidase test was performed after
16 h to analyze and photograph (magnification, ×40) specific
fusion events.
|
|
Chronically infected HeLa and SW480 cells were also cloned. We
analyzed 116 independent cell clones from
HeLa
mNDK and 16 from
SW480
mNDK.
Cocultures were performed with indicator cells, and
we observed that
80% of the HeLa clones were infected, 100% of
which had the mutant
tropism. Around the same percentage of SW480
cell clones were infected
(75%), of which 100% presented the mutant
entry phenotype (Table
2). All infected CD4-negative clones
expressed
viruses which exhibited the mutant tropism, although viral
supernatants
from the CEM
mNDK cell population contained a
mixed population
(compare Tables
1 and
2). Nonetheless, all the cloned
mutant
viruses were able to enter HeLaCD4 cells 5 to 15 times more
efficiently
than HeLa cells (depending on the clone [Tables
1 and
2]).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Cellular cloning of the mNDK-infected HeLa and SW480
populations: coculture analysis of cell clone entry phenotype
|
|
We concluded that the derived viral tropism is stable once acquired and
is associated with a viral genetic shift rather than
depending on a
particular cell type or cell clone.
CXCR4 is sufficient for viral entry.
U373MG cells were stably
cotransfected with a luciferase vector under the control of the HIV-1
LTR and an expression vector for CXCR4 or CCR5. As shown in the
representative experiment results in Fig.
4A, an 11-fold transactivation of the
luciferase reporter gene was observed after coculture of
U373MGCXCR4 cells with mNDK-infected CEM cells. A greater
fusion efficiency was observed with U373CXCR4 clone 31 (Fig. 4A), which expressed a higher level of CXCR4 protein (not shown).
These results show that CXCR4 acts as the receptor for mNDK virus. This
was confirmed by a May-Grunwald-Giemsa (MGG) in situ analysis of
cocultures of U373MGCXCR4 positive clone (clone 23) with
either CEMmNDK cells (Fig. 4B, panel b) or HTLV3b-infected H9 cells (Fig. 4B, panel a), resulting in the occurrence of large syncytia only with the mNDK isolate (Fig. 4B). In contrast, expression of CCR5 in U373MG cells did not allow syncytium formation with CEMmNDK cells (Fig. 4A).

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 4.
CXCR4 acts as the receptor for the derived virus. (A)
CXCR4 or CCR5 was transiently or stably cotransfected with the HIV
LTR-luciferase vector in the human U373MG cell line. Coculture
experiments were then performed with HTLV3b- or mNDK-infected H9 cells,
and Tat-directed transactivation was measured. Fold induction was
standardized in comparison to luciferase (Luc.) activities obtained for
cocultures with the nonderived virus. The experiments whose results are
presented are representative of at least three independent
manipulations. Pop., population; Cl., clone. (B) An in situ MGG test
was performed 8 h after cocultures between CXCR4-stabilized U373MG
clone 23 with HTLV3b-infected (a) or mNDK-infected (b) H9 cells.
Specific fusion events were analyzed and photographed under an original
magnification of ×80.
|
|
Next, we attempted cell-cell fusion inhibition using different
chemokines. The CXCR4 ligand SDF-1 (
2,
26) or the CCR5
ligand RANTES (
1) was added to HeLa CD4
+ or
CD4

indicator HIV-1
LTR-lacZ cells.
Fusions between those
cells and chronically HTLV3b- or mNDK-infected H9
cells were analyzed
8 h later by a CPRG

-galactosidase test
(Fig.
5). Specific inhibition
of
syncytium formation was observed when SDF-1 was used with either
mNDK-infected cells (98.7%) or HTLV3b-infected cells (95.4%)
when
HeLa CD4
+ indicator cells were used (Fig.
5A).
Syncytia were observed only
with mNDK virus when HeLa CD4

indicator cells were used and were specifically inhibited (97%)
with
the CXC chemokine SDF-1 (Fig.
5B). The CC chemokine RANTES
had no
effect. This suggests that mNDK uses CXCR4 directly as
a receptor and
can efficiently be competed with the specific receptor
ligand.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
SDF-1 specifically inhibits cell-cell fusion. SDF-1 (300 nM) or RANTES (300 nM) was added to 2 × 104 indicator
cells per well in a 96-well plate 30 min prior to addition of HTLV3b-
or mNDK-infected H9 cells or noninfected H9 cells (3 × 104 cells/well). Cocultures were performed in triplicate.
Analysis of fusion efficiency was performed 8 h after coculture by
a quantitative -galactosidase test using CPRG substrate.
-Galactosidase activities were quantified after 90 min at an optical
density of 570 nm (OD570). (A) Cell-cell fusion with
HeLaCD4 lacZ indicator cells. (B) Cell-cell fusion with HeLa
lacZ indicator cells. Untr., untreated cells.
|
|
We performed cocultures of mNDK-infected cells and CD4-positive,
CXCR4-negative U373MG cells. As no fusion could be detected,
we
concluded that CD4 alone could not allow cell fusion even though
the
mutated virus was used (not shown).
Cloning and functional analysis of env genes.
PCR-amplified env genes from different cell populations
infected with either derived or nonderived viruses (CEMNDK,
CEMmNDK, HeLamNDK, SW480mNDK,
H9H, and H9S) were cloned in a eucaryotic expression vector, as were the PCR-amplified env gene
fragments from CEM clones 15, 27, and 29 and HeLa clones 2, 14, and 48. The different envelope (Env) proteins expressed from those plasmids were designated according to the cell populations or cell clones they
were derived from.
env expression vectors were transfected into HeLa cells, and
cocultures with human CD4-positive or CD4-negative indicator
cells were
performed. All of the
env expression vectors from derived
viruses (either from cell populations or from cell clones) were
able to
form syncytia with CD4
+ and CD4

HeLa cells
(not shown). As previously observed for infected cells,
an increase in
fusion efficiency (ranging from 2- to 18-fold,
depending on the cell
clone) could be detected in the presence
of the CD4 molecule on the
cell surface. As expected, Env
15 (from
CEM clone 15),
Env
Ori (from the cloned NDK provirus
[
35]), and
Env
NDK (from nonderived
NDK-infected CEM cells) formed syncytia
only with HeLaCD4 indicator
cells. This shows that the
env gene
is responsible for the
CD4-independent phenotype and that the
CD4 molecule is not necessary
for viral entry, although it increases
fusion efficiency.
Molecular analysis of the env genes from derived
viruses.
We performed consensus sequence analysis on PCR-amplified
fragments from env genes of genomic DNA in
HeLamNDK, SW480mNDK, and CEMmNDK
cells. We sequenced whole env genes which we aligned and
compared with two reference sequences, from the cloned NDK provirus
(35) and the env gene from proviral nonderived
NDK virus from the infected CEM cell population. Silent point mutations were observed throughout the env coding sequence. However,
no mutations were found in gp41. The critical gp120 region V1, V2, V4,
and V5 loops and the CD4-binding domains also do not contain mutations.
In contrast, compared with the wild-type env gene, seven amino acid changes were observed in all sequenced
env genes from CEMmNDK, HeLamNDK,
and SW480mNDK cells. Two of them were located in the C2
region (D192
N192 and
T195
S195), four were in the V3 loop
(K296Y297T298
N296N297I298
and R307
G307), and one was in the C3 region
(A333
V333). The presence of these seven
specific mutations was confirmed after sequencing of the C2, V3, and C3
regions from the env genes from H9S and
H9H cells (Fig. 6A).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Consensus sequence of env genes. The
sequencing strategy used (see Materials and Methods) allowed detection
of only relevant mutations. The different origins of sequenced genes
and the panel of primers used gave the sequences twice on both strands.
(A) Schematic map of relevant mutations observed after consensus
sequencing performed directly on PCR-amplified env genes
from infected-cell populations of different origins.
EnvOri, sequences obtained from nonderived
CEMNDK cell population and from the cloned provirus
(35); EnvmNDK sequences obtained from different
derived cell populations: CEMmNDK, H9H,
H9S, HeLamNDK, and SW480mNDK. (B)
Schematic map of relevant mutations observed after consensus sequencing
performed on cloned env genes from different origins ligated
in the expression vector. Their ability to direct cell fusion when
expressed in HeLa cells has previously been tested. EnvNDK
and EnvNDKsb, clonotypic sequences from the env
gene from the nonderived CEMNDK cell population;
EnvCEM15, clonotypic sequence of the cellular clone 15 presenting a strict CD4-dependent entry phenotype;
EnvCEM29,27 and EnvHeLa2,14,48 clonotypic
sequences of cellular clones presenting a CD4-independent entry
phenotype. wt, wild type.
|
|
Some of the cloned
env genes were also sequenced to
correlate the fusion phenotype with the seven mutations. Cloned
env genes
from CEM clone 29 and HeLa clone 14 were
sequenced. As expected,
few silent mutations were found, and only the
seven mutations
previously observed were common to these two clones.
We have also isolated two
env genes carrying mutations that
are not associated with a CD4-independent entry phenotype. In
CEM clone
15, five mutations localized in the V3 and C3 regions
and identical to
those observed in derived
env genes were observed
(K
296Y
297T
298
N
296N
297I
298,
R
307
G
307, and
A
333
V
333 [Fig.
6B]). In the molecular
subclone Env
NDKsb, two mutations
in the V3 loop which were
not present in Env
wt
(K
296Y
297
N
296N
297)
were observed. These mutations correspond to two of the four
mutations
observed in all V3 loops from derived viruses and probably
represent
intermediate genotypes.
Virus names are based on the number of mutations in the
env
gene. Therefore, CD4-independent virus was designated m7 NDK,
and
CD4-dependent mutant viruses were designated m2 or m5 NDK.
V3 and C3 mutations associated with C2 changes are responsible for
the CD4 independence.
To link the onset of the derived phenotype
to the appearance of specific mutations, we constructed chimeras
between m5, m7, and wild-type NDK env genes which were
cloned into a eucaryotic expression vector. Transient transfections
into HeLa cells and coculture experiments with indicator cells were
performed. We observed that the C2 region from Envm7 cloned
in Envwt did not confer a CD4-independent phenotype. The
reverse chimera (C2 from Envwt cloned into
Envm7) revealed a loss of fusion with CD4-negative cells
(Fig. 7). When C2, V3, and C3 regions
from Envm7 were cloned in Envm5, the resulting
chimeric Env protein allowed a CD4-independent cell fusion. The amino
acid changes in the C2 domain thus correlate with the onset of the
mutant tropism in the context of modified V3-C3 regions. Since there is
no difference between those Env proteins other than these five or seven
mutations, it can be concluded that the appearance of CD4-independent
tropism requires seven mutations and that five of the seven mutations
in the V3-C3 region are not sufficient to allow CD4 independence. Work
is in progress to determine if all mutations are required to allow this
particular phenotype.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 7.
Chimeric constructs between derived or nonderived cloned
env genes. Regions were exchanged as indicated, with
EcoRV and HindIII sites used for the V3-C3
region and EcoRI and HindIII used for the C2,
V3, and C3 regions. The fusion phenotypes of the resulting chimeric
env expression vectors were analyzed by coculture between
transiently transfected HeLa cells and either CD4-positive or
CD4-negative HeLa lacZ indicator cells. An in situ X-Gal
assay was performed after 16 h of coculture. Results represent
schematic means of at least three to five independent experiments.
Scoring of syncytia was done as follows: , <5; ++, 50 to 200; +++,
200 to 1,000; and ++++, >1,000. wt, wild type.
|
|
 |
DISCUSSION |
We report here a spontaneous shift in cell tropism for a TCLA
laboratory HIV-1 isolate. This NDK derivative is able to infect some
human CD4-negative cell lines, such as HeLa, SW480, and Wish. This
adaptation is genetically stable, since chronically infected CD4-negative HeLa and SW480 cells could be obtained and since recurrent
infection of human CD4-positive T-cell line H9 with supernatants from
those adherent infected cell lines revealed a stable entry phenotype.
The host cell range of this virus proved that the alternate receptor
galactosylceramide is not implicated in the phenomenon, since U373MG,
HT29, and CaCo2 cells were not efficient in syncytium formation
(9, 17, 19). As expected for a long-term laboratory TCLA
isolate, complementation of the U373MG cell line with a CXCR4
expression vector and inhibition experiments using SDF-1 clearly
demonstrate that the mNDK virus uses CXCR4 as receptor, no longer
needing CD4. Our results also shown that mNDK is not able to use CCR5
(Fig. 4). Our virus is thus the first HIV-1 laboratory-adapted isolate
for which the CD4 molecule is not necessary for infection and which
interacts with its specific coreceptor, CXCR4.
We suggest the occurrence of a progressive genetic switch in HIV-1 NDK
cell tropism related to specific mutations in critical regions C2, V3,
and C3 of the env gene. The characterization of intermediate
genotypes with two amino acid changes in the V3 loop or five amino acid
changes in the C3-V3 regions (from Envm2 and Envm5, respectively) supports the idea of a progressive
evolution towards the seven mutations leading to a CD4-independent
entry phenotype. These seven mutations could be responsible for a
spontaneous exposure and better flexibility of the V3 loop. In all
cases, either infected-cell populations, infected-cell clones, or
transiently expressed Envm7 proteins always formed syncytia
5 to 10 times more efficiently with HeLaCD4 than with HeLa cells
(Tables 1 and 2 and Fig. 1 to 3). This indicates that although no
longer necessary, the CD4 molecule can still interact with the mutant gp120 and may optimize its fusogenic conformation. To support this, it
must be noted that this spontaneous change occurred in the human
CD4-positive T-cell line CEM without any selective pressure and that
once acquired, this phenotype was genetically stable. This clearly
indicates that this phenotype is favored in a genetically mixed viral
population (Table 1) and suggests a progressive adaptation of the Env
proteins in vitro to gain in infection efficiency and/or viral
replication.
The recent characterization of several members of the chemokine
receptors as the long-sought HIV entry cofactors (1, 4, 11, 12,
14, 18) raised the question of a direct interaction between viral
glycoproteins and the coreceptor. Some evidence suggests that
CD4-dependent isolates undergo a direct but weak interaction between
gp120 and CXCR4 (20) or CCR5 (37). A critical role for the V3 loop in this interaction has been reported (7, 36). This region of the viral gp120 influences cellular tropism and participates in coreceptor binding. Perhaps the function of CD4 is
limited to inducing changes in gp120 conformation allowing efficient
binding to the coreceptor and subsequent viral entry. This would
explain why although a direct interaction with CXCR4 might be possible,
the native gp120 conformation does not allow efficient interaction with
the coreceptor for membrane fusion to occur. This would prevent viral
entry in CXCR4-expressing CD4-negative cells and restrict the cellular
host range. A progressive increase in coreceptor binding affinity would
correlate with the possibility for gp120 to efficiently interact with
the coreceptor. Studies of CD4-independent HIV-2 isolates confirm that
an interaction with CXCR4 is sufficient to allow subsequent membrane
fusion (16). Among the mutations characterized for those
HIV-2 isolates, those found in V1, V2, and V3 loops could not be
associated with the CD4-independent phenotype (30). In
contrast, for the m7 NDK virus, we were able to correlate phenotype
changes with genetic modifications. There is no mutation in the V1, V2,
V4, and V5 regions and CD4-binding domains of gp120 or in the fusion
peptide of gp41. Nevertheless, four mutations in the V3 loop and three mutations in adjacent regions C2 and C3 were observed. We have demonstrated that these seven mutations are directly implicated in the
CD4-independent phenotype that was confirmed by fusion analysis of
chimeric env gene expression vectors. Mutations in the C2
and C3 regions could change the conformation of the V3 loop, which
could then interact directly with CXCR4.
The absence of fusion between m7 NDK and CD4-expressing, CXCR4-negative
U373MG cells suggests that CXCR4 is essential for viral entry, whereas
in some cases CD4 is dispensable. The availability of these modified
Env proteins thus represents a powerful tool with which to directly
analyze gp120 interaction with HIV-1 coreceptors.
 |
ACKNOWLEDGMENTS |
The proviral plasmid containing the complete NDK virus genome was
a kind gift from B. Spire. We thank T. Dragic for helpful discussion;
J. Moore and B. Moser, respectively, for CCR5 and CXCR4 expression
plasmids; and N. Tordo and Y. Jacob for kind help in sequence analysis.
This work was supported in part by grants from the Fondation pour la
Recherche Médicale (SIDACTION) and the Agence National de
Recherche contre le SIDA (ANRS). J.D. is supported by a fellowship from
the Ministère de l'Education Nationale, de l'Enseignement supérieur et de la Recherche. A.A. is supported by a fellowship from the Fondation pour la Recherche Médicale (SIDACTION).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: INSERM
Unité 380 Laboratoire de Pathologie et Génétique
Expérimentales, Institut Cochin de Génétique
Moléculaire, 22 rue Mechain, 75014 Paris, France. Phone:
331-40-51-64-55. Fax: 331-40-51-64-07. E-mail: hazan{at}cochin.inserm.fr.
 |
REFERENCES |
| 1.
|
Alkhatib, G.,
C. Combadiere,
C. C. Broder,
Y. Feng,
P. E. Kennedy,
P. M. Murphy, and E. A. Berger.
1996.
CC CKR5: A RANTES, MIP-1 alpha, MIP-1 beta receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 2.
|
Bleul, C. C.,
M. Farzan,
H. Choe,
C. Parolin,
I. Clarklewis,
J. Sodroski, and T. A. Springer.
1996.
The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry.
Nature
382:829-833[Medline].
|
| 3.
|
Chesebro, B.,
K. Wehrly,
J. Nishio, and S. Perryman.
1992.
Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T-cell tropic isolates: definition of critical amino acids involved in cell tropism.
J. Virol.
66:6547-6554[Abstract/Free Full Text].
|
| 4.
|
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P. D. Ponath,
L. J. Wu,
C. R. Mackay,
G. Larosa,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1996.
The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135-1148[Medline].
|
| 5.
|
Clapham, P. R.,
A. McKnight, and R. A. Weiss.
1992.
Human immunodeficiency virus type 2 infection and fusion of CD4-negative human cell lines: induction and enhancement by soluble CD4.
J. Virol.
66:3531-3537[Abstract/Free Full Text].
|
| 6.
|
Clark, L. I.,
B. Moser,
A. Walz,
M. Baggiolini,
G. J. Scott, and R. Aebersold.
1991.
Chemical synthesis, purification, and characterization of two inflammatory proteins, neutrophil activating peptide 1 (interleukin-8) and neutrophil activating peptide.
Biochemistry
30:3128-3135[Medline].
|
| 7.
|
Cocchi, F.,
A. L. Devico,
A. Garzinodemo,
A. Cara,
R. C. Gallo, and P. Lusso.
1996.
The V3 domain of the HIV-1 gp120 envelope glycoprotein is critical for chemokine-mediated blockade of infection.
Nat. Med.
2:1244-1247[Medline].
|
| 8.
|
Connor, R. I.,
K. E. Sheridan,
D. Ceradini,
S. Choe, and N. R. Landau.
1997.
Change in coreceptor use correlates with disease progression in HIV-1-infected individuals.
J. Exp. Med.
185:621-628[Abstract/Free Full Text].
|
| 9.
|
Cook, D. G.,
J. Fantini,
S. L. Spitalnik, and F. Gonzalez-Scarano.
1994.
Binding of human immunodeficiency virus type I (HIV-1) Gp120 to galactosylceramide (GalCer): relationship to V3 loop.
Virology
201:206-214[Medline].
|
| 10.
|
Dalgleish, A. G.,
P. C. L. Beverley,
P. R. Clapham,
D. H. Crawford,
M. F. Greaves, and R. A. Weiss.
1984.
The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus.
Nature
312:763-766[Medline].
|
| 11.
|
Deng, H. K.,
R. Liu,
W. Ellmeier,
S. Choe,
D. Unutmaz,
M. Burkhart,
P. Dimarzio,
S. Marmon,
R. E. Sutton,
C. M. Hill,
C. B. Davis,
S. C. Peiper,
T. J. Schall,
D. R. Littman, and N. R. Landau.
1996.
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661-666[Medline].
|
| 12.
|
Doranz, B. J.,
J. Rucker,
Y. J. Yi,
R. J. Smyth,
M. Samson,
S. C. Peiper,
M. Parmentier,
R. G. Collman, and R. W. Doms.
1996.
A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.
Cell
85:1149-1158[Medline].
|
| 12a.
| Dragic, T. Personal communication.
|
| 13.
|
Dragic, T., and M. Alizon.
1993.
Different requirements for membrane fusion mediated by the envelopes of human immunodeficiency virus types 1 and 2.
J. Virol.
67:2355-2359[Abstract/Free Full Text].
|
| 14.
|
Dragic, T.,
V. Litwin,
G. P. Allaway,
S. R. Martin,
Y. X. Huang,
K. A. Nagashima,
C. Cayanan,
P. J. Maddon,
R. A. Koup,
J. P. Moore, and W. A. Paxton.
1996.
HIV-1 entry into CD4(+) cells is mediated by the chemokine receptor CC-CKR-5.
Nature
381:667-673[Medline].
|
| 15.
|
Ellrodt, A.,
F. Barre-Sinoussi,
P. Le Bras,
M. T. Nugeyre,
L. Palazzo,
F. Rey,
F. Brun-Vezinet,
C. Rouzioux,
P. Segond,
R. Caquet,
L. Montagnier, and J.-C. Chermann.
1984.
Isolation of a new human T-lymphotropic retrovirus (LAV) from a married couple of Zairians, one with AIDS, the other with prodromes.
Lancet
i:1383-1385.
|
| 16.
|
Endres, M. J.,
P. R. Clapham,
M. Marsh,
M. Ahuja,
J. Davis-Turner,
A. McKnight,
J. F. Thomas,
B. Stoebenau-Haggarty,
S. Choe,
P. J. Vance,
T. N. C. Wells,
C. A. Power,
S. S. Sutterwala,
R. W. Doms,
N. R. Landau, and J. A. Hoxie.
1996.
CD4-independent infection by HIV-2 is mediated by fusin/CXCR-4.
Cell
87:745-756[Medline].
|
| 17.
|
Fantini, J.,
D. G. Cook,
N. Nathanson,
S. L. Spitalnik, and F. Gonzalez-Scarano.
1993.
Infection of colonic epithelial cell lines by type 1 human immunodeficiency virus is associated with cell surface expression of galactosylceramide, a potential alternative gp120 receptor.
Proc. Natl. Acad. Sci. USA
90:2700-2704[Abstract/Free Full Text].
|
| 18.
|
Feng, Y.,
C. C. Broder,
P. E. Kennedy, and E. A. Berger.
1996.
HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor.
Science
272:872-877[Abstract].
|
| 19.
|
Harouse, J. M.,
S. Bhat,
S. L. Spitalnik,
M. Laughlin,
K. Stefano,
D. H. Silberberg, and F. Gonzalez-Scarano.
1991.
Inhibition of entry of HIV-1 in neural cell lines by antibodies against galactosylceramide.
Science
253:320-323[Abstract/Free Full Text].
|
| 20.
|
Hesselgesser, J.,
M. Halks-Miller,
V. Delvecchio,
S. C. Peiper,
J. Hoxie,
D. L. Kolson,
D. Taub, and R. Horuk.
1997.
CD4-independent association between HIV-1 gp120 and CXCR-4: functional chemokine receptors are expressed in human neurons.
Curr. Biol.
7:112-121[Medline].
|
| 21.
|
Hwang, S. R.,
T. J. Boyle,
K. Lyerly, and B. R. Cullen.
1992.
Identification of the envelope V3 loop as the primary determinant of cell tropism in HIV-1.
Science
253:71-74.
|
| 22.
|
Klatzmann, D.,
E. Champagne,
S. Chamaret,
J. Gruest,
D. Guétard,
T. Hercend,
J.-C. Gluckman, and L. Montagnier.
1984.
T-lymphocyte T4 molecule behaves as the receptor for human retrovirus LAV.
Nature
312:767-768[Medline].
|
| 23.
|
Lasky, L. A.,
G. Nakamura,
D. H. Smith,
C. Fennie,
C. Shimasaki,
E. Patzer,
P. Berman,
T. Gregory, and D. J. Capon.
1987.
Delineation of a region of the human immunodeficiency virus type 1 gp120 glycoprotein critical for interaction with the CD4 receptor.
Cell
50:975-985[Medline].
|
| 24.
|
Loetscher, M.,
T. Geiser,
T. O'Reilly,
R. Zwahlen,
M. Baggiolini, and B. Moser.
1994.
Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes.
J. Biol. Chem.
269:232-237[Abstract/Free Full Text].
|
| 25.
| Moore, J. P., and P. L. Nara. 1991. The
role of the V3 loop of gp120 in HIV infection. AIDS 5(Suppl.
2):S21-S33.
|
| 26.
|
Oberlin, E.,
A. Amara,
F. Bachelerie,
C. Bessia,
J. L. Virelizier,
F. Arenzanaseisdedos,
O. Schwartz,
J. M. Heard,
I. Clarklewis,
D. F. Legler,
M. Loetscher,
M. Baggiolini, and B. Moser.
1996.
The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1.
Nature
382:833-835[Medline].
|
| 27.
|
O'Brien, W. A.,
Y. Koyanagi,
A. Namazie,
J. Q. Zhao,
A. Diagne,
K. Idler,
J. A. Zack, and I. S. Chen.
1990.
HIV-1 tropism for mononuclear phagocytes can be determined by regions of gp120 outside the CD4-binding domain.
Nature
348:69-73[Medline].
|
| 28.
|
Olshevsky, U.,
E. Helseth,
C. Furman,
J. Li,
W. Haseltine, and J. Sodroski.
1990.
Identification of individual human immunodeficiency virus type 1 gp120 amino acids important for CD4 receptor binding.
J. Virol.
64:5701-5707[Abstract/Free Full Text].
|
| 29.
|
Popovic, M.,
M. G. Sarngadharan,
E. Read, and R. C. Gallo.
1984.
Detection, isolation, and continuous production of cytopathic retroviruses (HTLV-III) from patients with AIDS and pre-AIDS.
Science
224:497-500[Abstract/Free Full Text].
|
| 30.
|
Reeves, J. D., and T. F. Schulz.
1997.
The CD4-independent tropism of human immunodeficiency virus type 2 involves several regions of the envelope protein and correlates with a reduced activation threshold for envelope-mediated fusion.
J. Virol.
71:1453-1465[Abstract].
|
| 31.
|
Sattentau, Q. J., and J. P. Moore.
1991.
Conformational changes induced in the human immunodeficiency virus envelope glycoprotein by soluble CD4 binding.
J. Exp. Med.
174:407-415[Abstract/Free Full Text].
|
| 32.
|
Shioda, T.,
J. A. Levy, and M. C. Cheng.
1991.
Macrophage and T cell-line tropisms of HIV-1 are determined by specific regions of the envelope gp120 gene.
Nature
349:167-169[Medline].
|
| 33.
|
Shioda, T.,
J. A. Levy, and M. C. Cheng.
1992.
Small amino acid changes in the V3 hypervariable region of gp120 can affect the T-cell-line and macrophage tropism of human immunodeficiency virus type 1.
Proc. Natl. Acad. Sci. USA
89:9434-9438[Abstract/Free Full Text].
|
| 34.
|
Sol, N.,
F. Morinet,
M. Alizon, and U. Hazan.
1993.
Trans-activation of the long terminal repeat of the human immunodeficiency virus type 1 by the parvovirus B19 NS1 gene product.
J. Gen. Virol.
74:2011-2014[Abstract/Free Full Text].
|
| 35.
|
Spire, B.,
J. Sire,
V. Zachar,
F. Rey,
F. Barre-Sinoussi,
F. Galibert,
A. Hampe, and J.-C. Chermann.
1989.
Nucleotide sequence of HIV1-NDK: a highly cytopathic strain of the human immunodeficiency virus.
Gene
81:275-284[Medline].
|
| 36.
|
Trkola, A.,
T. Dragic,
J. Arthos,
J. M. Binley,
W. C. Olson,
G. P. Allaway,
C. Chengmayer,
J. Robinson,
P. J. Maddon, and J. P. Moore.
1996.
CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR-5.
Nature
384:184-187[Medline].
|
| 37.
|
Wu, L. J.,
N. P. Gerard,
R. Wyatt,
H. Choe,
C. Parolin,
N. Ruffing,
A. Borsetti,
A. A. Cardoso,
E. Desjardin,
W. Newman,
C. Gerard, and J. Sodroski.
1996.
CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5.
Nature
384:179-183[Medline].
|
J Virol, January 1998, p. 512-519, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Perugi, F., Muriaux, D., Ramirez, B. C., Chabani, S., Decroly, E., Darlix, J.-L., Blot, V., Pique, C.
(2009). Human Discs Large Is a New Negative Regulator of Human Immunodeficiency Virus-1 Infectivity. Mol. Biol. Cell
20: 498-508
[Abstract]
[Full Text]
-
Taylor, B. M., Foulke, J. S., Flinko, R., Heredia, A., DeVico, A., Reitz, M.
(2008). An Alteration of Human Immunodeficiency Virus gp41 Leads to Reduced CCR5 Dependence and CD4 Independence. J. Virol.
82: 5460-5471
[Abstract]
[Full Text]
-
Ryu, B. Y., Zavorotinskaya, T., Trentin, B., Albritton, L. M.
(2008). The block to membrane fusion differs with the site of ligand insertion in modified retroviral envelope proteins. J. Gen. Virol.
89: 1049-1058
[Abstract]
[Full Text]
-
Chien, M.-P., Jiang, S., Chang, D.-K.
(2008). The function of coreceptor as a basis for the kinetic dissection of HIV type 1 envelope protein-mediated cell fusion. FASEB J.
22: 1179-1192
[Abstract]
[Full Text]
-
Kubo, Y., Yokoyama, M., Yoshii, H., Mitani, C., Tominaga, C., Tanaka, Y., Sato, H., Yamamoto, N.
(2007). Inhibitory role of CXCR4 glycan in CD4-independent X4-tropic human immunodeficiency virus type 1 infection and its abrogation in CD4-dependent infection. J. Gen. Virol.
88: 3139-3144
[Abstract]
[Full Text]
-
Lin, G., Bertolotti-Ciarlet, A., Haggarty, B., Romano, J., Nolan, K. M., Leslie, G. J., Jordan, A. P.-O., Huang, C.-c., Kwong, P. D., Doms, R. W., Hoxie, J. A.
(2007). Replication-Competent Variants of Human Immunodeficiency Virus Type 2 Lacking the V3 Loop Exhibit Resistance to Chemokine Receptor Antagonists. J. Virol.
81: 9956-9966
[Abstract]
[Full Text]
-
Waheed, A. A., Ablan, S. D., Mankowski, M. K., Cummins, J. E., Ptak, R. G., Schaffner, C. P., Freed, E. O.
(2006). Inhibition of HIV-1 Replication by Amphotericin B Methyl Ester: SELECTION FOR RESISTANT VARIANTS. J. Biol. Chem.
281: 28699-28711
[Abstract]
[Full Text]
-
Wyss, S., Dimitrov, A. S., Baribaud, F., Edwards, T. G., Blumenthal, R., Hoxie, J. A.
(2005). Regulation of Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Fusion by a Membrane-Interactive Domain in the gp41 Cytoplasmic Tail. J. Virol.
79: 12231-12241
[Abstract]
[Full Text]
-
Zerhouni, B., Nelson, J. A. E., Saha, K.
(2004). Isolation of CD4-Independent Primary Human Immunodeficiency Virus Type 1 Isolates That Are Syncytium Inducing and Acutely Cytopathic for CD8+ Lymphocytes. J. Virol.
78: 1243-1255
[Abstract]
[Full Text]
-
Vermeire, K., Schols, D.
(2003). Specific CD4 down-modulating compounds with potent anti-HIV activity. J. Leukoc. Biol.
74: 667-675
[Abstract]
[Full Text]
-
McKnight, A., Weiss, R. A.
(2003). Blocking the docking of HIV-1. Proc. Natl. Acad. Sci. USA
100: 10581-10582
[Full Text]
-
Rainey, G. J. A., Natonson, A., Maxfield, L. F., Coffin, J. M.
(2003). Mechanisms of Avian Retroviral Host Range Extension. J. Virol.
77: 6709-6719
[Abstract]
[Full Text]
-
Vermeire, K., Bell, T. W., Choi, H.-J., Jin, Q., Samala, M. F., Sodoma, A., De Clercq, E., Schols, D.
(2003). The Anti-HIV Potency of Cyclotriazadisulfonamide Analogs Is Directly Correlated with Their Ability to Down-Modulate the CD4 Receptor. Mol. Pharmacol.
63: 203-210
[Abstract]
[Full Text]
-
Lin, G., Baribaud, F., Romano, J., Doms, R. W., Hoxie, J. A.
(2002). Identification of gp120 Binding Sites on CXCR4 by Using CD4-Independent Human Immunodeficiency Virus Type 2 Env Proteins. J. Virol.
77: 931-942
[Abstract]
[Full Text]
-
Gallina, A., Hanley, T. M., Mandel, R., Trahey, M., Broder, C. C., Viglianti, G. A., Ryser, H. J.-P.
(2002). Inhibitors of Protein-Disulfide Isomerase Prevent Cleavage of Disulfide Bonds in Receptor-bound Glycoprotein 120 and Prevent HIV-1 Entry. J. Biol. Chem.
277: 50579-50588
[Abstract]
[Full Text]
-
Reeves, J. D., Doms, R. W.
(2002). Human immunodeficiency virus type 2. J. Gen. Virol.
83: 1253-1265
[Full Text]
-
Puffer, B. A., Pohlmann, S., Edinger, A. L., Carlin, D., Sanchez, M. D., Reitter, J., Watry, D. D., Fox, H. S., Desrosiers, R. C., Doms, R. W.
(2002). CD4 Independence of Simian Immunodeficiency Virus Envs Is Associated with Macrophage Tropism, Neutralization Sensitivity, and Attenuated Pathogenicity. J. Virol.
76: 2595-2605
[Abstract]
[Full Text]
-
Edwards, T. G., Wyss, S., Reeves, J. D., Zolla-Pazner, S., Hoxie, J. A., Doms, R. W., Baribaud, F.
(2002). Truncation of the Cytoplasmic Domain Induces Exposure of Conserved Regions in the Ectodomain of Human Immunodeficiency Virus Type 1 Envelope Protein. J. Virol.
76: 2683-2691
[Abstract]
[Full Text]
-
Foley, H. D., Otero, M., Orenstein, J. M., Pomerantz, R. J., Schnell, M. J.
(2002). Rhabdovirus-Based Vectors with Human Immunodeficiency Virus Type 1 (HIV-1) Envelopes Display HIV-1-Like Tropism and Target Human Dendritic Cells. J. Virol.
76: 19-31
[Abstract]
[Full Text]
-
Lin, G., Lee, B., Haggarty, B. S., Doms, R. W., Hoxie, J. A.
(2001). CD4-Independent Use of Rhesus CCR5 by Human Immunodeficiency Virus Type 2 Implicates an Electrostatic Interaction between the CCR5 N Terminus and the gp120 C4 Domain. J. Virol.
75: 10766-10778
[Abstract]
[Full Text]
-
Overbaugh, J., Miller, A. D., Eiden, M. V.
(2001). Receptors and Entry Cofactors for Retroviruses Include Single and Multiple Transmembrane-Spanning Proteins as well as Newly Described Glycophosphatidylinositol-Anchored and Secreted Proteins. Microbiol. Mol. Biol. Rev.
65: 371-389
[Abstract]
[Full Text]
-
Lane, B. R., Strieter, R. M., Coffey, M. J., Markovitz, D. M.
(2001). Human Immunodeficiency Virus Type 1 (HIV-1)-Induced GRO-{alpha} Production Stimulates HIV-1 Replication in Macrophages and T Lymphocytes. J. Virol.
75: 5812-5822
[Abstract]
[Full Text]
-
Lehner, T., Doyle, C., Wang, Y., Babaahmady, K., Whittall, T., Tao, L., Bergmeier, L., Kelly, C.
(2001). Immunogenicity of the Extracellular Domains of C-C Chemokine Receptor 5 and the In Vitro Effects on Simian Immunodeficiency Virus or HIV Infectivity. J. Immunol.
166: 7446-7455
[Abstract]
[Full Text]
-
Edwards, T. G., Hoffman, T. L., Baribaud, F., Wyss, S., LaBranche, C. C., Romano, J., Adkinson, J., Sharron, M., Hoxie, J. A., Doms, R. W.
(2001). Relationships between CD4 Independence, Neutralization Sensitivity, and Exposure of a CD4-Induced Epitope in a Human Immunodeficiency Virus Type 1 Envelope Protein. J. Virol.
75: 5230-5239
[Abstract]
[Full Text]
-
Dumonceaux, J., Goujon, C., Joliot, V., Briand, P., Hazan, U.
(2001). Determination of Essential Amino Acids Involved in the CD4-Independent Tropism of the X4 Human Immunodeficiency Virus Type 1 m7NDK Isolate: Role of Potential N Glycosylations in the C2 and V3 Regions of gp120. J. Virol.
75: 5425-5428
[Abstract]
[Full Text]
-
de Parseval, A., Elder, J. H.
(2001). Binding of Recombinant Feline Immunodeficiency Virus Surface Glycoprotein to Feline Cells: Role of CXCR4, Cell-Surface Heparans, and an Unidentified Non-CXCR4 Receptor. J. Virol.
75: 4528-4539
[Abstract]
[Full Text]
-
Martín, J., LaBranche, C. C., González-Scarano, F.
(2001). Differential CD4/CCR5 Utilization, gp120 Conformation, and Neutralization Sensitivity between Envelopes from a Microglia-Adapted Human Immunodeficiency Virus Type 1 and Its Parental Isolate. J. Virol.
75: 3568-3580
[Abstract]
[Full Text]
-
Kolchinsky, P., Kiprilov, E., Bartley, P., Rubinstein, R., Sodroski, J.
(2001). Loss of a Single N-Linked Glycan Allows CD4-Independent Human Immunodeficiency Virus Type 1 Infection by Altering the Position of the gp120 V1/V2 Variable Loops. J. Virol.
75: 3435-3443
[Abstract]
[Full Text]
-
Kolchinsky, P., Kiprilov, E., Sodroski, J.
(2001). Increased Neutralization Sensitivity of CD4-Independent Human Immunodeficiency Virus Variants. J. Virol.
75: 2041-2050
[Abstract]
[Full Text]
-
Holmen, S. L., Melder, D. C., Federspiel, M. J.
(2001). Identification of Key Residues in Subgroup A Avian Leukosis Virus Envelope Determining Receptor Binding Affinity and Infectivity of Cells Expressing Chicken or Quail Tva Receptor. J. Virol.
75: 726-737
[Abstract]
[Full Text]
-
Valente, S. T., Chanel, C., Dumonceaux, J., Olivier, R., Marullo, S., Briand, P., Hazan, U.
(2001). CXCR4 Is Down-Regulated in Cells Infected with the CD4-Independent X4 Human Immunodeficiency Virus Type 1 Isolate m7NDK. J. Virol.
75: 439-447
[Abstract]
[Full Text]
-
Zhang, Y.-j., Lou, B., Lal, R. B., Gettie, A., Marx, P. A., Moore, J. P.
(2000). Use of Inhibitors To Evaluate Coreceptor Usage by Simian and Simian/Human Immunodeficiency Viruses and Human Immunodeficiency Virus Type 2 in Primary Cells. J. Virol.
74: 6893-6910
[Abstract]
[Full Text]
-
Borsetti, A., Parolin, C., Ridolfi, B., Sernicola, L., Geraci, A., Ensoli, B., Titti, F.
(2000). CD4-Independent Infection of Two CD4-/CCR5-/CXCR4+ Pre-T-Cell Lines by Human and Simian Immunodeficiency Viruses. J. Virol.
74: 6689-6694
[Abstract]
[Full Text]
-
Lerner, D. L., Elder, J. H.
(2000). Expanded Host Cell Tropism and Cytopathic Properties of Feline Immunodeficiency Virus Strain PPR Subsequent to Passage through Interleukin-2-Independent T Cells. J. Virol.
74: 1854-1863
[Abstract]
[Full Text]
-
Shieh, J. T. C., Martín, J., Baltuch, G., Malim, M. H., González-Scarano, F.
(2000). Determinants of Syncytium Formation in Microglia by Human Immunodeficiency Virus Type 1: Role of the V1/V2 Domains. J. Virol.
74: 693-701
[Abstract]
[Full Text]
-
LaBranche, C. C., Hoffman, T. L., Romano, J., Haggarty, B. S., Edwards, T. G., Matthews, T. J., Doms, R. W., Hoxie, J. A.
(1999). Determinants of CD4 Independence for a Human Immunodeficiency Virus Type 1 Variant Map outside Regions Required for Coreceptor Specificity. J. Virol.
73: 10310-10319
[Abstract]
[Full Text]
-
Kolchinsky, P., Mirzabekov, T., Farzan, M., Kiprilov, E., Cayabyab, M., Mooney, L. J., Choe, H., Sodroski, J.
(1999). Adaptation of a CCR5-Using, Primary Human Immunodeficiency Virus Type 1 Isolate for CD4-Independent Replication. J. Virol.
73: 8120-8126
[Abstract]
[Full Text]
-
Mirzabekov, T., Bannert, N., Farzan, M., Hofmann, W., Kolchinsky, P., Wu, L., Wyatt, R., Sodroski, J.
(1999). Enhanced Expression, Native Purification, and Characterization of CCR5, a Principal HIV-1 Coreceptor. J. Biol. Chem.
274: 28745-28750
[Abstract]
[Full Text]
-
Nisole, S., Krust, B., Callebaut, C., Guichard, G., Muller, S., Briand, J.-P., Hovanessian, A. G.
(1999). The Anti-HIV Pseudopeptide HB-19 Forms a Complex with the Cell-surface-expressed Nucleolin Independent of Heparan Sulfate Proteoglycans. J. Biol. Chem.
274: 27875-27884
[Abstract]
[Full Text]
-
Murakami, T., Zhang, T.-Y., Koyanagi, Y., Tanaka, Y., Kim, J., Suzuki, Y., Minoguchi, S., Tamamura, H., Waki, M., Matsumoto, A., Fujii, N., Shida, H., Hoxie, J. A., Peiper, S. C., Yamamoto, N.
(1999). Inhibitory Mechanism of the CXCR4 Antagonist T22 against Human Immunodeficiency Virus Type 1 Infection. J. Virol.
73: 7489-7496
[Abstract]
[Full Text]
-
Dumonceaux, J., Chanel, C., Valente, S., Quivet, L., Briand, P., Hazan, U.
(1999). Mutations in the env gene of human immunodeficiency virus type 1 NDK isolates and the use of African green monkey CXCR4 as a co-receptor in COS-7 cells. J. Gen. Virol.
80: 1975-1982
[Abstract]
[Full Text]
-
Schenten, D., Marcon, L., Karlsson, G. B., Parolin, C., Kodama, T., Gerard, N., Sodroski, J.
(1999). Effects of Soluble CD4 on Simian Immunodeficiency Virus Infection of CD4-Positive and CD4-Negative Cells. J. Virol.
73: 5373-5380
[Abstract]
[Full Text]
-
Hoffman, T. L., LaBranche, C. C., Zhang, W., Canziani, G., Robinson, J., Chaiken, I., Hoxie, J. A., Doms, R. W.
(1999). Stable exposure of the coreceptor-binding site in a CD4-independent HIV-1 envelope protein. Proc. Natl. Acad. Sci. USA
96: 6359-6364
[Abstract]
[Full Text]
-
Maréchal, V., Arenzana-Seisdedos, F., Heard, J.-M., Schwartz, O.
(1999). Opposite Effects of SDF-1 on Human Immunodeficiency Virus Type 1 Replication. J. Virol.
73: 3608-3615
[Abstract]
[Full Text]
-
Richardson, J., Pancino, G., Merat, R., Leste-Lasserre, T., Moraillon, A., Schneider-Mergener, J., Alizon, M., Sonigo, P., Heveker, N.
(1999). Shared Usage of the Chemokine Receptor CXCR4 by Primary and Laboratory-Adapted Strains of Feline Immunodeficiency Virus. J. Virol.
73: 3661-3671
[Abstract]
[Full Text]
-
Lee, B., Ratajczak, J., Doms, R. W., Gewirtz, A. M., Ratajczak, M. Z.
(1999). Coreceptor/Chemokine Receptor Expression on Human Hematopoietic Cells: Biological Implications for Human Immunodeficiency Virus-Type 1 Infection. Blood
93: 1145-1156
[Abstract]
[Full Text]
-
Ohagen, A., Ghosh, S., He, J., Huang, K., Chen, Y., Yuan, M., Osathanondh, R., Gartner, S., Shi, B., Shaw, G., Gabuzda, D.
(1999). Apoptosis Induced by Infection of Primary Brain Cultures with Diverse Human Immunodeficiency Virus Type 1 Isolates: Evidence for a Role of the Envelope. J. Virol.
73: 897-906
[Abstract]
[Full Text]
-
Follis, K. E., Trahey, M., LaCasse, R. A., Nunberg, J. H.
(1998). Continued Utilization of CCR5 Coreceptor by a Newly Derived T-Cell Line-Adapted Isolate of Human Immunodeficiency Virus Type 1. J. Virol.
72: 7603-7608
[Abstract]
[Full Text]
-
Wyatt, R., Sodroski, J.
(1998). The HIV-1 Envelope Glycoproteins: Fusogens, Antigens, and Immunogens. Science
280: 1884-1888
[Abstract]
[Full Text]