Previous Article | Next Article 
J Virol, January 1998, p. 104-112, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Repression of the A8L Gene, Encoding the Early
Transcription Factor 82-Kilodalton Subunit, Inhibits Morphogenesis of
Vaccinia Virions
Xiaolei
Hu,
Elizabeth J.
Wolffe,
Andrea S.
Weisberg,
Lawrence J.
Carroll,
and
Bernard
Moss*
Laboratory of Viral Diseases, National
Institute of Allergy and Infectious Diseases, Bethesda, Maryland
20892-0445
Received 14 August 1997/Accepted 22 September 1997
 |
ABSTRACT |
The vaccinia virus early transcription factor (VETF) is a DNA
binding protein comprised of 70- and 82-kDa subunits encoded by the D6R
and A8L genes, respectively. A previous investigation suggested a novel
role for the 70-kDa subunit in the morphogenesis of vaccinia virus
particles. The principal objectives of the present study were to
determine if the 82-kDa subunit of VETF is also required for
morphogenesis and, if so, whether the block occurs before or after the
incorporation of the genome into the assembling virus particle. To
address these and other questions, we constructed and characterized a
conditionally lethal recombinant vaccinia virus in which the A8L gene
is stringently repressed by the Escherichia coli lac
operator system. The amount of 82-kDa protein synthesized could be
regulated by the amount of inducer: from undetectable to higher than
normal levels. Virus replication, as determined by plaque formation or
virus yield upon synchronous infection, was dependent on inducer.
Nevertheless, de novo synthesis of the 82-kDa subunit was not required
for viral early, intermediate, and late gene expression or DNA
replication. Overexpression of the A8L gene alone, produced by high
concentrations of inducer, inhibited viral late protein synthesis,
whereas overexpression of the D6R gene alone or both VETF genes
simultaneously had little inhibitory effect. Laser confocal
fluorescence and quantitative electron microscopic analyses revealed
that immature and DNA-containing intermediate stage particles
accumulated in the absence of inducer, indicating that the A8L protein
has a role in morphogenesis of the core and subsequent events.
 |
INTRODUCTION |
Vaccinia virus, the prototypic
member of the poxvirus family, encodes enzymes and factors needed for
replication and expression of its double-stranded DNA genome within the
cytoplasm of host cells (25). Viral gene expression is
transcriptionally regulated and divided into three successive stages:
early, intermediate, and late. The viral DNA-dependent RNA polymerase
contains at least eight virus-encoded subunits and is used for
transcription of genes belonging to all three classes. The
virus-encoded proteins needed for early transcription are present in
the infecting virus particles, having been synthesized and
assembled along with the viral structural proteins. Thus, de novo
synthesis of viral proteins is not required for early transcription,
which can occur in the presence of inhibitors of protein
synthesis. The translation products of viral early mRNAs include RNA
polymerase and factors needed for intermediate transcription, which
occurs after DNA replication. Late transcription follows
intermediate, because some late transcription factors are encoded by
viral intermediate mRNAs.
The factors specific for early transcription have been more thoroughly
characterized than those for the other stages. At least two proteins,
the RNA polymerase-associated protein of 94 kDa (RAP94 [1, 2,
12]) and the vaccinia virus early transcription factor (VETF
[9]), confer early promoter specificity to the RNA polymerase. RAP94, the product of the H4L
gene, is thought to interact with VETF, although this has not been
directly shown. VETF is a heterodimeric protein with subunits of
approximately 70 and 82 kDa encoded by the D6R and A8L genes,
respectively (5, 17). VETF binds specifically to early
promoters (6, 7, 11) and recruits the RNA polymerase to form
the initiation complex (3, 22). Upon addition of
ribonucleoside triphosphates, a stable ternary complex is formed
(18, 19). The 70-kDa subunit of VETF has an intrinsic ATPase
activity (8) that may be involved in promoter clearance
(4).
The process by which the components of the early transcription system
are specifically incorporated into assembling virions is not yet
understood. Insights came from an analysis of a recombinant vaccinia
virus with an inducible H4L gene encoding RAP94 (36). In the
absence of inducer, noninfectious mature-appearing virus particles
lacking RNA polymerase as well as many enzymes involved in mRNA
biosynthesis were formed. The finding that VETF is packaged in the
absence of RAP94 led to the suggestion that promoter-bound VETF
recruits RNA polymerase to the assembly complex, in much the same way
as VETF recruits RNA polymerase for transcription. To investigate this
possibility, we constructed a conditionally lethal recombinant vaccinia
virus with an inducible D6R gene (20). In the presence of
inducer, infectious virus particles containing VETF formed. When cells
were infected with these particles in the absence of inducer, viral
early, intermediate, and late gene expression occurred, demonstrating
that only the incoming packaged form of VETF is required for gene
expression. In this respect, the phenotype resembled that of the
RAP94-inducible mutant. Differences in the phenotypes were apparent,
however, when the infected cells were examined by electron microscopy.
Immature viral particles accumulated when the D6R gene was repressed,
suggesting that the 70-kDa subunit of VETF has a more basic role in
morphogenesis than RAP94. The genome of vaccinia virus is thought to
enter immature virus particles in the form of an electron-dense
nucleoid (24). Because of its specific DNA binding
properties, we proposed that VETF, together with other proteins, might
serve as a chaperone to escort the genome into assembling particles.
The possibility remained, however, that the role of the 70-kDa
polypeptide in morphogenesis was independent of its association with
the 82-kDa subunit of VETF. Indeed, there are precedents for vaccinia
virus proteins having several independent functions. For example,
the cap-specific methyltransferase encoded by the J3R gene exists in
monomeric and heterodimeric forms and functions as a cap-specific
methyltransferase and a poly(A) polymerase elongation factor (16,
30). It was important, therefore, to determine the phenotype of a
mutant vaccinia virus that does not express the 82-kDa subunit of VETF.
Here, we describe the construction and characterization of a
conditionally lethal recombinant vaccinia virus with an inducible A8R
gene and demonstrate the accumulation of immature and DNA-containing
intermediate stage particles under nonpermissive conditions.
 |
MATERIALS AND METHODS |
Cells and viruses.
Monolayers of BS-C-1 or CV-1 cells were
grown in Eagle's minimum essential medium (EMEM) with 10% fetal
bovine serum (FBS). HeLa S3 cells grown in Dulbecco's minimum
essential medium with 10% FBS were used for preparation of virus
stocks. Wild-type vaccinia virus (WR strain) and vGW3 (34)
were prepared as described previously (20). Inducible mutant
viruses were propagated in HeLa S3 monolayers in EMEM supplemented with
2% FBS and 100 µM isopropyl-
-D-thiogalactopyranoside (IPTG).
Construction of recombinant vaccinia virus containing an
inducible copy of the A8L gene.
Procedures for the construction of
the A8L-inducible virus were similar to those described for a
D6R-inducible virus (20). Briefly, the A8L open reading
frame was amplified by PCR and inserted into pMITEOlac.20/3
so that it was regulated by a bacteriophage T7 promoter,
Escherichia coli lac operator (lacO), and a cDNA copy of the encephalomyocarditis virus leader and flanked by vaccinia virus hemagglutinin (HA) sequences. This plasmid was transfected into
cells infected with VT7lacOI (34), which contains a T7 RNA
polymerase gene regulated by the vaccinia virus late P11 promoter and a
lacO and a vaccinia virus early/late P7.5 promoter-regulated lac repressor (lacI) gene. Several recombinant
viruses were plaque purified thrice under agar in the presence of
mycophenolic acid. The genotypes of these viruses were verified by PCR.
The recombinant virus code named vLJC1 is referred to as
vA8ind+end+, signifying the presence of
endogenous and inducible copies of the A8L gene.
Deletion of the endogenous copy of the A8L gene was carried out in a
manner analogous to that used for the D6R gene (20). The
neomycin resistance gene (neo) was obtained by digestion of pVVNEO (13) with SalI and BamHI,
subcloned into the pGEM-3 vector to form plasmid pGEM-NEO. DNA on
either side of the A8L gene was PCR amplified by using the following
primer pairs: (i) GCGCGCGTCGACCTTGGATGATGGATACTTGAGAGTTG and
GGGGGGGTCGACATTTATATCGTGGGGTAAAGTGAAAATCTACTACC and (ii)
GCGCGCGGATCCCCCAACTCTGGAAGAGCACAAATAAATTAAAC and
GGGGGGGGATCCGGAATCGGATACTATATCTTCGGTATCTTGACGCAG. The
PCR products were cloned into an intermediate plasmid and subsequently into pGEM-NEO. The resulting plasmid, pA8KO, contains 5' and 3' sequences adjacent to the A8L gene at each side of neo with
no residual A8L coding sequences. Plasmid pA8KO was mixed with
Lipofectamine (Promega) and transfected into
vA8ind+end+-infected CV-1 cells; the incubation
was continued in the presence of 100 µM IPTG and 2 µg of G418 per
ml. After three rounds of plaque purification in the presence of IPTG
and G418, deletion of the A8L gene was confirmed by PCR. The
recombinant virus was designated vA8ind since it contains a single
inducible copy of the A8L gene. Virus stocks were prepared in HeLa
cells in the presence of 100 µM IPTG.
Plaque assay.
BS-C-1 monolayers in six-well plates were
infected with 10-fold serial dilutions of virus for 1 h and
incubated at 37°C for 2 days in EMEM containing 2% FBS and 100 µM
IPTG when appropriate. The cells were then stained with crystal violet,
and the plaques were counted.
One-step growth of vaccinia viruses.
Monolayers of BS-C-1
cells were infected with 10 PFU of virus per cell for 1 h at
37°C, washed, and incubated at various times with or without IPTG.
Cells were harvested, frozen and thawed three times, sonicated, and
stored at
80°C. Virus titers were determined by plaque assay.
SDS-PAGE.
BS-C-1 cells in six-well plates were infected with
10 or 20 PFU of recombinant vaccinia viruses per cell at 37°C. Cells
were labeled with 100 µCi of [35S]methionine per well
for 15 min and lysed in sodium dodecyl sulfate (SDS) electrophoresis
buffer for SDS-polyacrylamide gel electrophoresis (PAGE) analysis or in
Nonidet P-40 (NP-40) lysis buffer (1.0% NP-40, 150 mM NaCl, 50 mM
Tris-HCl [pH 8.0]) at 4°C for 10 min. Insoluble material was
removed by sedimentation in a microcentrifuge at 4°C for 5 min, and
the supernatant was incubated with antiserum at 4°C for 12 h and
then with excess protein A-agarose beads for 2 h. The beads were
subsequently washed with NP-40 lysis buffer and 25 mM Tris buffer (pH
8.8). SDS-containing sample buffer was added to the beads and heated at
100°C for 3 min, and the supernatant was applied to an
SDS-polyacrylamide gel.
Antibodies.
Rabbit polyclonal antisera to the 70- and 82-kDa
subunits of VETF have been described elsewhere (17).
Monoclonal antibody (MAb) C3, to the protein encoded by the A27L open
reading frame of vaccinia virus (28), was provided by M. Esteban. Fluorescein isothiocyanate (FITC)-labeled rabbit anti-mouse
antiserum was purchased from Dako Corporation (Carpinteria, Calif.).
Confocal microscopy.
Viral particles and DNA were
colocalized by indirect immunofluorescence and propidium iodide
staining. HeLa cells were grown on glass coverslips to approximately 70 to 80% confluency and were infected in the presence or absence of 100 µg of rifampin per ml or 100 µM IPTG. At 18 h after infection,
cells were fixed with 3% paraformaldehyde in phosphate-buffered saline
for 20 min at room temperature and permeabilized, RNase treated, and
processed as previously described (21) except that DNA was
stained with 10% propidium iodide and virus particles were visualized
with mAb C3 followed by FITC-conjugated rabbit anti-mouse antibody (immunoglobulin G [IgG]). Cells were visualized with a Zeiss Axioplan microscope, and images were captured with a Bio-Rad MRC 1024 laser confocal imaging system.
Electron microscopy.
BS-C-1 monolayers in 60-mm-diameter
dishes were infected with 10 PFU of virus per cell in the presence or
absence of 100 µM IPTG and fixed at various times in 2%
glutaraldehyde (EM Sciences) in 100 mM phosphate buffer (pH 7.4) for
1 h. Cells were then prepared in Epon resin for transmission
electron microscopy by osmication, dehydration, and embedding. Thin
sections were cut, collected on Formvar-coated copper mesh grids
(Polysciences), and stained with 2% uranyl acetate and Reynolds' lead
citrate (26). Samples were viewed with a Philips CM100
electron microscope.
 |
RESULTS |
Construction of a mutant vaccinia virus with an inducible A8L
gene.
The systems originally used to inducibly regulate expression
of vaccinia virus genes had the E. coli lacO placed just
downstream of a vaccinia virus promoter (14, 29, 37). Ward
et al. (34) developed a more versatile version in which one
lacO was placed next to a vaccinia virus promoter that
regulates the bacteriophage T7 RNA polymerase gene and a second
lacO was placed next to a T7 promoter that regulates a
recombinant gene. In addition to greatly enhanced repression in the
absence of inducer, due to two lacO-regulated steps, the new
system permits overexpression at high inducer concentrations. Following
our successful use of the two operator system to regulate the D6R gene,
encoding the 70-kDa subunit of VETF (20), we applied a
similar strategy to regulate the A8L gene encoding the 82-kDa subunit.
Figure 1 shows the important features of
the recombinant vaccinia virus, vA8ind, containing an inducible copy of
the A8L gene. Of special note are (i) at the thymidine kinase (TK)
locus, the vaccinia virus P11 late promoter and lacO
regulate the T7 RNA polymerase gene and the constitutively expressed
vaccinia virus P7.5 promoter regulates lacI; (ii) the
neo gene, regulated by the P7.5 promoter, replaces the
endogenous A8L gene; and (iii) at the HA locus, the T7 promoter and
lacO regulate the A8L gene and the P7.5 promoter regulates
the gpt gene. The neo and gpt genes
were used for antibiotic selection. vA8ind was constructed in two
steps, starting with a recombinant virus (vlacOI) containing the
indicated insertion in the TK gene (Fig. 1). The first step was
the construction of the intermediate virus
(vA8end+ind+) by insertion of the inducible
copy of the A8L gene into the HA locus (Fig. 1). The latter virus was
selected with mycophenolic acid, identified by the formation of
syncytial plaques due to interruption of the HA gene, and genotyped by
PCR. In the second step, the neo gene was inserted into the
A8L locus. The recombinant vaccinia virus, vA8ind, was selected in the
presence of G418 and IPTG and identified by PCR.

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 1.
Representation of the genome of vA8ind. The TK, A8L, and
HA loci are shown. Abbreviations: P11, a vaccinia virus late promoter;
lacO, E. coli lac operator; T7, bacteriophage T7
RNA polymerase gene; P7.5, a vaccinia virus early/late promoter;
lacI, E. coli lac repressor gene; neo,
E. coli neomycin resistance gene; gpt, E. coli gpt gene; PT7, bacteriophage T7 promoter; EMC, cDNA copy of
the encephalomyocarditis virus leader. Arrowheads indicate directions
of transcription.
|
|
Effect of IPTG on virus replication.
The conditional lethal
nature of vA8ind was revealed by plaque assay. IPTG was needed for
formation of visible plaques by vA8ind but not for either the standard
laboratory strain of vaccinia virus, WR, nor for the intermediate
vA8end+ind+, which retains the original A8L
gene in addition to the inducible copy (Fig.
2). Microscopic examination of the cell
monolayers revealed that vA8ind formed pinpoint foci (not shown) that
may be due to secretion of viral growth factors (10) during
early gene expression in the absence of IPTG.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of IPTG on virus plaque formation. BS-C-1 cell
monolayers were infected with the wild-type vaccinia virus (WR),
vA8ind+end+, or vA8ind in the presence (+) or
absence ( ) of 100 µM IPTG. The cells were stained with crystal
violet at 48 h after infection.
|
|
The conditional lethality of vA8ind was further examined by determining
one-step virus yields in the presence or absence of
100 µM IPTG (Fig.
3). Without IPTG, little or no increase
in titer
of vA8ind was detected; with IPTG, there was nearly a 2-log
increase.
Further experiments indicated that the yield of vA8ind was
slightly
higher at 20 µM than at 100 µM IPTG (not shown). In
contrast,
the yield of vA8end
+ind
+ was
unaffected by IPTG and was similar to vA8ind in the presence
of
inducer. Replication of WR virus was also unaffected by IPTG
but was
higher than that of the genetically engineered recombinant
viruses. For
this reason, vA8end
+ind
+ was the preferred
control in some experiments.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of IPTG on virus yields. BS-C-1 cells were
infected with 10 PFU of wild-type virus (WR),
vA8ind+end+, or vA8ind per cell in the presence
(+) or absence ( ) of 100 µM IPTG. The cells were harvested at the
indicated times after infection, and the titers were determined by
plaque assay in the presence of 100 µM IPTG.
|
|
Inducer-dependent expression of the 82-kDa subunit of VETF.
Cells that had been infected with WR,
vA8end+ind+, or vA8ind in the presence or
absence of 100 µM IPTG were pulse-labeled at intervals with
[35S]methionine. Extracts were prepared and incubated
with a specific antibody to the A8L protein, and the bound materials
were analyzed by SDS-PAGE and autoradiography. A prominent 82-kDa band
was synthesized starting at 6 h after infection of cells with
vA8ind or vA8end+ind+ in the presence of
inducer (Fig. 4). The timing was
consistent with the late promoter used for transcription of the T7 RNA
polymerase gene. In the absence of inducer, a faint 82-kDa band derived
from the endogenous A8L gene was detectable in lysates of cells
infected with vA8end+ind+ but not in cells
infected with vA8ind (Fig. 4). A similarly faint 82-kDa band was
detected when cells were infected with wild-type WR virus (not shown),
indicating that the recombinant viruses vA8ind and
vA8end+ind+ were overexpressing the protein in
the presence of 100 µM IPTG.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 4.
Inducible expression of the A8L gene. BS-C-1 cells were
uninfected (lane u) or infected with
vA8ind+end+ (lanes e) or vA8ind (lanes i) in
the presence (+) or absence ( ) of 100 µM IPTG. The cells were
metabolically labeled with [35S]methionine at the
indicated times after infection (hours postinfection [HPI]), and
lysates were incubated with a polyclonal antibody to the A8L protein
and then with protein A beads. The bound proteins were analyzed by
SDS-PAGE. The positions of the 82-kDa A8L protein and the bacteriophage
T7 RNA polymerase (pol) are indicated. Lane m, marker proteins, with
masses indicated in kilodaltons.
|
|
Since VETF is a heterodimer of 82- and 70-kDa subunits, their
coprecipitation with either an A8L- or a D6R-specific antiserum
would
be expected. Although the 70-kDa subunit was not clearly
resolved in
Fig.
4, it was visualized in other experiments using
an A8L-specific
antiserum (not shown). Using a D6R-specific antiserum,
we found that
neither under- nor overexpression of the A8L gene
grossly affected the
synthesis (Fig.
5) or stability (not
shown)
of the 70-kDa subunit of VETF. When the 82-kDa subunit was
overexpressed,
it coprecipitated with the 70-kDa subunit when the
D6R-specific
antiserum was used (Fig.
5). Bands corresponding to T7 RNA
polymerase
were present in the +IPTG lanes of Fig.
4 and
5, presumably
because
the recombinant A8L and D6 proteins used to immunize the
rabbits
had been prepared with a bacteriophage T7 bacterial expression
vector, rather than because of coprecipitation with the viral
proteins.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 5.
Expression of the D6R gene is independent of A8L gene
expression. The experiment was carried out as described in the legend
to Fig. 4 except that rabbit polyclonal antiserum to the D6R protein
was used for immunoprecipitation. Arrows indicate the positions of T7
RNA polymerase and the 82- and 70-kDa subunits of VETF. For other
details, see the legend to Fig. 4.
|
|
Effect of IPTG on viral protein synthesis.
Since vA8ind was
propagated in the presence of IPTG, the infectious virions contain
VETF. The expectation was, therefore, that early and late transcription
would occur normally in cells infected with vA8ind in the absence of
IPTG. The effect of IPTG on the regulation of viral protein synthesis
was determined by pulse-labeling cells with
[35S]methionine for 15-min intervals at 2, 6, 12, and
18 h after infection with vA8ind or
vA8end+ind+. The proteins were resolved by
SDS-PAGE and autoradiography (Fig. 6).
The results obtained with the control
vA8end+ind+ in the absence of IPTG are
described first. At 2 h after infection, the labeled protein bands
were similar to those of uninfected cells except for decreases in their
intensity; as frequently occurs, early viral proteins were not clearly
resolved because of the low amounts made and the continued synthesis of
host proteins. At 6 h, the prominent pattern produced by the
abundant late proteins was established and persisted with little change
for the remainder of the infection. In the presence of 100 µM IPTG,
bands corresponding to T7 RNA polymerase and the 82-kDa A8L protein
were also detected. The intensity of viral bands became progressively
weaker at 12 and 18 h in the presence of IPTG. The pattern of
labeled viral proteins from cells infected with vA8ind was virtually
identical to that of vA8end+ind+ in the
presence or absence of IPTG (Fig. 6). Since viral protein synthesis was
higher under nonpermissive conditions in the absence of IPTG than under
permissive conditions in the presence of IPTG, the defect in virus
replication could hardly be caused by a general reduction in viral
protein synthesis.

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 6.
Synthesis of viral proteins. Uninfected BS-C-1 cells
(lane u) or cells infected with 10 PFU of
vA8ind+end+ (lanes e) or vA8ind (lanes i) in
the presence (+) or absence ( ) of 100 µM IPTG were pulse-labeled
for 15 min with [35S]methionine at the indicated times
after infection, lysed in SDS sample buffer, and analyzed by SDS-PAGE.
Lane m, protein markers, with masses indicated in kilodaltons. The
82-kDa A8L protein and the T7 RNA polymerase (pol) are indicated with
arrows.
|
|
We further investigated the IPTG-induced inhibition of viral protein
synthesis caused by the A8L mutant, since this was not
apparent with
the inducible D6R mutant (
20). In our expression
system, the
amount of target protein produced is proportional
to the inducer
concentration (
34). Infections, in 100 or 500
µM
IPTG-containing media, were carried out with 20 PFU of either
vA8ind,
vD6ind, or
lacZ-inducible virus vGW3 per cell or with
a
mixture of 10 PFU of vA8ind and 10 PFU of vD6ind per cell. The
infected
cells were labeled with [
35S]methionine for 15 min at
12 h after infection, the usual time
of maximal vaccinia virus
protein synthesis. In cells infected
with vA8ind at the higher
concentration of IPTG, the 82-kDa band
was more intense whereas other
viral bands were greatly diminished
(Fig.
7, lanes
A). The 70-kDa protein encoded by D6R,
which migrated
slightly ahead of the 69-kDa marker, was not resolved
from other
viral proteins; nevertheless, comparison of the various
lanes
indicated that the band including the D6R protein was most
intense
in lanes D, consistent with its overexpression by the
D6R-inducible
mutant as previously shown (
20).
Significantly, other viral
proteins were not greatly diminished in
cells infected with vD6R
at 500 µM IPTG compared to 100 µM IPTG. A
strong reduction in
labeling of viral proteins was also not seen in
cells infected
with vGW3, even though

-galactosidase was highly
expressed at
these IPTG concentrations (Fig.
7, lane G). Therefore, the
inhibition
of viral protein synthesis was specifically related to
overexpression
of the A8L gene product. Interestingly, the inhibition
of viral
protein synthesis did not occur when cells were coinfected
with
vD6ind and vA8ind even though the 82-kDa protein was overexpressed
(Fig.
7, lanes A/D). This was not simply due to coinfection per
se,
because the inhibition still occurred when cells were coinfected
with
vA8ind and vGW3 or when the amounts of vD6ind and vA8ind
were each
doubled for coinfection (data not shown). One explanation
for these
results is that the inhibitory activity of the 82-kDa
subunit was
abrogated by complexing with the overexpressed 72-kDa
subunit, which
itself is not toxic (
20).

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 7.
Inhibition of viral late protein synthesis by
overexpression of A8L. BS-C-1 cells were infected with 20 PFU of vA8ind
(lanes A), vD6ind (lanes D), or vGW3 (lanes G), or with 10 PFU of
vA8ind and 10 PFU of vD6ind (lanes A/D), per cell in the presence of
100 or 500 µM IPTG as indicated. After 12 h, the cells were
lysed in SDS sample buffer and analyzed by SDS-PAGE. Lane U, lysate of
similarly labeled uninfected BS-C-1 cells; lane M, protein markers,
with masses indicated in kilodaltons. The -galactosidase ( -gal)
and the 82-kDa and unresolved 70-kDa protein bands are indicated with
arrows.
|
|
Colocalization of viral DNA and particles.
Laser scanning
confocal microscopy was used to determine whether DNA-containing viral
particles formed under nonpermissive as well as permissive conditions.
Virus particles at intermediate and later stages of morphogenesis were
labeled by using MAb C3 to the 14-kDa virion surface protein encoded by
the A27L gene (31). Cells were infected with vA8ind in the
presence or absence of IPTG. Viral and cellular DNA were visualized
with propidium iodide, and virus particles were stained with MAb C3
followed by a FITC-conjugated second antibody (IgG). The absence of
bleed-through from the green (FITC) channel was verified by using
identical settings for infected cells that had not been stained with
propidium iodide. Staining of cellular DNA in the nucleus was evident,
and viral DNA was clearly visualized in the cytoplasm of infected cells. Two patterns of viral DNA were noted: large perinuclear masses,
resembling previous descriptions of Hoechst-stained viral factories,
were most clearly demarcated early in infection (not shown),
whereas punctate staining particles were only seen late in
infection (Fig. 8). Most, but not all, of
the punctate DNA colocalized with virus particles detected by the
anti-14kDa protein MAb. Correspondingly, nearly all MAb-staining
particles appeared to localize with DNA. Similar patterns were obtained
in the presence or absence of IPTG, except for an impression that more
of the large, discrete DNA factories persisted until later times of
infection under the latter conditions. The punctate staining did not
occur with either propidium iodide or the MAb when the cells were
infected in the presence of rifampin, an inhibitor of an early step in viral morphogenesis, consistent with the identification of these structure as viral particles (data not shown).

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 8.
Confocal microscopic images of cells infected with
vA8ind in the absence (A8 ) or presence (A8+) of 100 µM IPTG.
Infected HeLa cells were stained with either propidium iodide (PI) or
MAb C3 followed by FITC-conjugated rabbit anti-mouse IgG. The images
obtained with the red (PI), green (MAb C3), and merged channels are
shown.
|
|
Viral morphogenesis under permissive and nonpermissive
conditions.
Electron microscopy was used to analyze the viral
particles that formed under nonpermissive conditions. High-power images are shown of cells infected with vA8ind in the presence (Fig. 9A) or absence (Fig. 9B) of IPTG. We
derived the viral structures into five classes: crescents, spherical
immature particles without nucleoids, spherical immature particles with
nucleoids, spherical dense particles, and brick-shaped mature
particles. In the presence of IPTG, there were large numbers of
crescent, immature, and mature forms. In the absence of IPTG, there
were mostly crescents, immature forms and dense particles, which lacked
the brick shape and internal structure of virions, and few mature
particles. The numbers of each type are listed in Table
1. Only a minority of immature particles
contained visible nucleoids in the ultrathin sections; however,
nucleoids were at least as abundant in the absence of IPTG as in the
presence of IPTG. The differences between cells infected in the
presence and absence of inducer were noted at 18, 24, and 48 h
after infection, indicating that morphogenesis was not merely delayed.

View larger version (168K):
[in this window]
[in a new window]
|
FIG. 9.
Electron microscopic images of vA8ind-infected cells.
BS-C-1 cells were infected with vA8ind in the presence (A) or absence
(B) of IPTG. Abbreviations: c, crescents; i, immature particles; n,
nucleoids; d, dense particles; m, mature particles. The arrow in panel
B points to a large granular mass present in areas that contain large
numbers of immature particles. The bar represents 1 µm.
|
|
Under abortive conditions, there were also large masses of granular
material resembling the internal contents of immature
virions.
Crescents, partially enclosing some of the granular material,
are
present at the periphery of the masses (Fig.
9). Such large
masses were
infrequently encountered in the presence of IPTG at
any of the times
examined or in wild-type virus infections, but
they have been found
under a variety of conditions in which virus
particle formation is
inhibited.
 |
DISCUSSION |
The assembly and morphogenesis of infectious poxvirus particles is
a complex process requiring the interactions of membranes, numerous
proteins, and DNA. One aspect of virion assembly, unique to poxviruses,
is the incorporation of a complete stage-specific transcriptional
system. We have combined genetic and electron microscopic approaches to
gain insights into these processes. Conditionally lethal, inducible
mutants with a null phenotype provide an alternative to
temperature-sensitive mutants. Such mutants have now been made for the
three genes, H4L, D6R, and A8L, that are known to encode proteins that
are specific for early transcription. Repression of the H4L gene,
encoding RAP94, did not grossly interfere with morphogenesis of virus
particles, even though RNA polymerase and numerous other enzymes were
not packaged (36). The finding of DNA and VETF in these
enzyme-deficient particles suggested that VETF is normally recruited
before or independently of RAP94. If the only role of VETF in assembly
were to bind RNA polymerase, then repression of either VETF subunit might result in the formation of particles resembling those that formed
without RAP94. A previous study showed, however, that repression of D6R
interferes with morphogenesis (20). This unexpected finding raised questions that have been addressed in the present study. The
first was whether repression of the A8L subunit would give rise to a
phenotype similar to that found when D6R was repressed. Presuming that
morphogenesis was interrupted, the second question was whether this
occurred before or after entry of the DNA genome into viral particles.
Given the DNA binding properties of VETF, the former possibility was
favored.
To address the first question, we constructed a recombinant vaccinia
virus that contains a copy of the A8L gene under lacO control and then deleted the original A8L gene. The resulting virus,
vA8ind, was dependent on IPTG for replication. Under nonpermissive conditions, the phenotype of vA8ind was virtually identical to that of
the previous vD6ind mutant. Thus, viral protein synthesis proceeded
normally in the absence of A8L expression, indicating that the packaged
VETF was sufficient for viral early gene expression and that de novo
synthesis of the 82-kDa protein was not required for viral intermediate
or late gene expression. In the presence of IPTG, the amount of 82-kDa
protein was much higher than during wild-type infection, making this
virus a possible source of material uncomplexed to the 70-kDa subunit.
In a similar manner, vD6ind makes much higher amounts of 70-kDa subunit
than occur during infection with wild-type virus (20).
Nevertheless, we have not yet tried to purify the individual subunits
from soluble extracts.
Masternak and Wittek (23) reported that overexpression of
both subunits of VETF, by coinfection of cells with two recombinant viruses, inhibited synthesis of vaccinia virus late proteins. The
effects of individually overexpressed subunits were not reported. We
observed that overexpression of the 82-kDa protein resulted in
inhibition of viral late protein synthesis, whereas overexpression of
the 70-kDa protein did not. Moreover, the inhibitory effect caused by
overexpression of the 82-kDa protein was prevented by coexpression of
70-kDa subunit. Cross-linking studies have shown that the 82-kDa
subunit of VETF can bind DNA in vitro without sequence specificity
(11), suggesting a possible general transcriptional inhibitory effect of the overexpressed 82-kDa subunit. In vitro studies
with purified subunits would be useful for further investigations of
this phenomenon.
When expression of the A8L gene was repressed, the defect in vaccinia
virus replication occurred during virion morphogenesis. We wished to
know whether the A8L gene was required for incorporating DNA into the
assembling virions. Although use of anti-DNA antibodies for
immunoelectron microscopy has been described (32), the
sensitivity of staining vaccinia virus particles was too low for our
purposes. Recently, Vanderplasschen and Smith (33) described
the use of laser scanning confocal microscopy to visualize vaccinia
virus particles on the cell surface. We used a similar technique to colocalize DNA and virus particles within the cell cytoplasm. Infected
cells were permeabilized, digested with RNase, and stained with
propidium iodide, a DNA-intercalating agent. Perinuclear viral
factories were prominently stained at early times, whereas there was a
more dispersed punctate staining pattern at late times. The latter DNA
colocalized with particles that bound antibody directed to a virion
surface protein. Such DNA-containing particles did not form in the
presence of rifampin, an inhibitor of an early step in morphogenesis.
However, they did form when A8L gene expression was repressed,
indicating that the latter protein was not required for encapsidation
of DNA. This colocalization technique may be useful for characterizing
other vaccinia virus mutants that have defects in morphogenesis.
Quantitative electron microscopy revealed that there were increased
numbers of immature and dense intermediate particles but relatively few
apparently mature ones in cells infected with vA8ind in the absence,
compared to the presence, of IPTG. The few mature-looking particles
that formed in the absence of IPTG could represent either leaky
expression of the A8L gene or inefficient VETF-independent maturation,
and they may not be infectious. There were similar numbers of immature
particles with nucleoids, thought to contain the viral DNA genome
(24), in the absence of IPTG as in its presence. The actual
number of nucleoids was quite low, however, possibly because they
occurred infrequently in the plane of the ultrathin sections. Taking
the confocal and electron microscopy results together, we concluded
that a block occurs predominantly at an intermediate stage in
morphogenesis, after the incorporation of the DNA genome but before the
formation of a recognizable core structure. Although we did not
quantitate the various types of particles in our previous study of
repression of the D6R gene (20), the electron microscopic
images were virtually identical to those shown here for vA8ind.
VETF and other DNA binding proteins could have direct roles in
morphogenesis of the viral core. An alternative, indirect mechanism for
VETF was considered previously in the context of repression of the D6R
gene (20). We suggested that de novo synthesis of VETF might
be required for transcription of a unique set of late genes that encode
proteins required for morphogenesis. Such a late role for VETF could be
consistent with the transcriptional reactivation of certain early
promoters at late times (15). However, this idea remains
speculative, as reactivatable promoters have not been demonstrated in
association with genes encoding structural proteins.
To further study the packaging of enzymes and other internal proteins
during assembly, we may need to adapt immunoelectron microscopic
methods that have been effectively used to monitor the recruitment of
viral membrane proteins during morphogenesis (27, 32, 35).
Antibodies with high avidities and specificities will be needed,
together with procedures to avoid high backgrounds caused by the
soluble cytoplasmic proteins.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Viral Diseases, NIAID, NIH, 4 Center Dr., MSC 0445, Bethesda, MD
20892-0445. Phone: (301) 496-9869. Fax: (301) 480-1147. E-mail:
bmoss{at}nih.gov.
Present address: U.S. Patent Office, Arlington, VA 22241.
 |
REFERENCES |
| 1.
|
Ahn, B.-Y.,
P. D. Gershon, and B. Moss.
1994.
RNA-polymerase associated protein RAP94 confers promoter specificity for initiating transcription of vaccinia virus early stage genes.
J. Biol. Chem.
269:7552-7557[Abstract/Free Full Text].
|
| 2.
|
Ahn, B.-Y., and B. Moss.
1992.
RNA polymerase-associated transcription specificity factor encoded by vaccinia virus.
Proc. Natl. Acad. Sci. USA
89:3536-3540[Abstract/Free Full Text].
|
| 3.
|
Baldick, C. J.,
M. C. Cassetti,
N. Harris, and B. Moss.
1994.
Ordered assembly of a functional preinitiation transcription complex, containing vaccinia virus early transcription factor and RNA polymerase, on an immobilized template.
J. Virol.
68:6052-6056[Abstract/Free Full Text].
|
| 4.
|
Broyles, S. S.
1991.
A role for ATP hydrolysis in vaccinia virus early gene transcription.
J. Biol. Chem.
266:15545-15548[Abstract/Free Full Text].
|
| 5.
|
Broyles, S. S., and B. S. Fesler.
1990.
Vaccinia virus gene encoding a component of the viral early transcription factor.
J. Virol.
64:1523-1529[Abstract/Free Full Text].
|
| 6.
|
Broyles, S. S., and J. Li.
1993.
The small subunit of the vaccinia virus early transcription factor contacts the transcription promoter DNA.
J. Virol.
67:5677-5680[Abstract/Free Full Text].
|
| 7.
|
Broyles, S. S.,
J. Li, and B. Moss.
1991.
Promoter DNA contacts made by the vaccinia virus early transcription factor.
J. Biol. Chem.
266:15539-15544[Abstract/Free Full Text].
|
| 8.
|
Broyles, S. S., and B. Moss.
1988.
DNA-dependent ATPase activity associated with vaccinia virus early transcription factor.
J. Biol. Chem.
263:10761-10765[Abstract/Free Full Text].
|
| 9.
|
Broyles, S. S.,
L. Yuen,
S. Shuman, and B. Moss.
1988.
Purification of a factor required for transcription of vaccinia virus early genes.
J. Biol. Chem.
263:10754-10760[Abstract/Free Full Text].
|
| 10.
|
Buller, R. M. L.,
S. Chakrabarti,
B. Moss, and T. Frederickson.
1988.
Cell proliferative response to vaccinia virus is mediated by VGF.
Virology
164:182-192[Medline].
|
| 11.
|
Cassetti, M. C., and B. Moss.
1996.
Interaction of the 82-kDa subunit of the vaccinia virus early transcription factor heterodimer with the promoter core sequence directs downstream DNA binding of the 70-kDa subunit.
Proc. Natl. Acad. Sci. USA
93:7540-7545[Abstract/Free Full Text].
|
| 12.
|
Deng, S., and S. Shuman.
1994.
A role for the H4 subunit of vaccinia RNA polymerase in transcription initiation at a viral early promoter.
J. Biol. Chem.
269:14323-14329[Abstract/Free Full Text].
|
| 13.
|
Franke, C. A.,
C. M. Rice,
J. H. Strauss, and D. E. Hruby.
1985.
Neomycin resistance as a dominant selectable marker for selection and isolation of vaccinia virus recombinants.
Mol. Cell. Biol.
5:1918-1924[Abstract/Free Full Text].
|
| 14.
|
Fuerst, T. R.,
M. P. Fernandez, and B. Moss.
1989.
Transfer of the inducible lac repressor/operator system from Escherichia coli to a vaccinia virus expression vector.
Proc. Natl. Acad. Sci. USA
86:2549-2553[Abstract/Free Full Text].
|
| 15.
|
Garcés, J.,
K. Maternak,
B. Kunz, and R. Wittek.
1993.
Reactivation of transcription from a vaccinia virus early promoter late in infection.
J. Virol.
67:5394-5401[Abstract/Free Full Text].
|
| 16.
|
Gershon, P. D.,
B. Y. Ahn,
M. Garfield, and B. Moss.
1991.
Poly(A) polymerase and a dissociable polyadenylation stimulatory factor encoded by vaccinia virus.
Cell
66:1269-1278[Medline].
|
| 17.
|
Gershon, P. D., and B. Moss.
1990.
Early transcription factor subunits are encoded by vaccinia virus late genes.
Proc. Natl. Acad. Sci. USA
87:4401-4405[Abstract/Free Full Text].
|
| 18.
|
Hagler, J., and S. Shuman.
1992.
Ternary complex formation by vaccinia virus RNA polymerase at an early viral promoter: analysis by native gel electrophoresis.
J. Virol.
66:2982-2989[Abstract/Free Full Text].
|
| 19.
|
Hagler, J., and S. Shuman.
1992.
Structural analysis of ternary complexes of vaccinia virus RNA polymerase.
Proc. Natl. Acad. Sci. USA
89:10090-10103.
|
| 20.
|
Hu, X.,
L. J. Carroll,
E. J. Wolffe, and B. Moss.
1996.
De novo synthesis of the early transcription factor 70-kDa subunit is required for morphogenesis of vaccinia virions.
J. Virol.
70:7669-7677[Abstract].
|
| 21.
|
Kovacs, G. R., and B. Moss.
1996.
The vaccinia virus H5R gene encodes late gene transcription factor 4: purification, cloning, and overexpression.
J. Virol.
70:6796-6802[Abstract/Free Full Text].
|
| 22.
|
Li, J., and S. S. Broyles.
1993.
Recruitment of vaccinia virus RNA polymerase to an early gene promoter by the viral early transcription factor.
J. Biol. Chem.
268:2773-2780[Abstract/Free Full Text].
|
| 23.
|
Masternak, K., and R. Wittek.
1996.
cis- and trans-acting elements involved in reactivation of vaccinia virus early transcription.
J. Virol.
70:8737-8746[Abstract].
|
| 24.
|
Morgan, C.
1976.
The insertion of DNA into vaccinia virus.
Science
193:591-592[Abstract/Free Full Text].
|
| 25.
|
Moss, B.
1996.
Poxviridae: the viruses and their replication, p. 2637-2671. In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2.
Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 26.
|
Reynolds, E. S.
1963.
The use of lead citrate at high pH as an electron-opaque stain in electron microscopy.
J. Cell Biol.
17:208[Free Full Text].
|
| 27.
|
Rodríguez, D.,
C. Risco,
J. R. Rodríguez,
J. L. Carrascosa, and M. Esteban.
1996.
Inducible expression of the vaccinia virus A17L gene provides a synchronized system to monitor sorting of viral proteins during morphogenesis.
J. Virol.
70:7641-7653[Abstract].
|
| 28.
|
Rodriguez, J. F.,
R. Janeczko, and M. Esteban.
1985.
Isolation and characterization of neutralizing monoclonal antibodies to vaccinia virus.
J. Virol.
56:482-488[Abstract/Free Full Text].
|
| 29.
|
Rodriguez, J. F., and G. L. Smith.
1990.
Inducible gene expression from vaccinia virus.
Virology
177:239-250[Medline].
|
| 30.
|
Schnierle, B. S.,
P. D. Gershon, and B. Moss.
1992.
Cap-specific mRNA (nucleoside-O2'-)-methyltransferase and poly(A) polymerase stimulatory activities of vaccinia virus are mediated by a single protein.
Proc. Natl. Acad. Sci. USA
89:2897-2901[Abstract/Free Full Text].
|
| 31.
|
Sodeik, B.,
S. Cudmore,
M. Ericsson,
M. Esteban,
E. G. Niles, and G. Griffiths.
1995.
Assembly of vaccinia virus: incorporation of p14 and p32 into the membrane of the intracellular mature virus.
J. Virol.
69:3560-3574[Abstract].
|
| 32.
|
Sodeik, B.,
R. W. Doms,
M. Ericsson,
G. Hiller,
C. E. Machamer,
W. van't Hof,
G. van Meer,
B. Moss, and G. Griffiths.
1993.
Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks.
J. Cell Biol.
121:521-541[Abstract/Free Full Text].
|
| 33.
|
Vanderplasschen, A., and G. L. Smith.
1997.
A novel virus binding assay using confocal microscopy: demonstration that intracellular and extracellular vaccinia virions bind to different cellular receptors.
J. Virol.
71:4032-4041[Abstract].
|
| 34.
|
Ward, G. A.,
C. K. Stover,
B. Moss, and T. R. Fuerst.
1995.
Stringent chemical and thermal regulation of recombinant gene expression by vaccinia virus vectors in mammalian cells.
Proc. Natl. Acad. Sci. USA
92:6773-6777[Abstract/Free Full Text].
|
| 35.
|
Wolffe, E. J.,
D. M. Moore,
P. J. Peters, and B. Moss.
1996.
Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis.
J. Virol.
70:2797-2808[Abstract].
|
| 36.
|
Zhang, Y.,
B.-Y. Ahn, and B. Moss.
1994.
Targeting of a multicomponent transcription apparatus into assembling vaccinia virus particles requires RAP94, an RNA polymerase-associated protein.
J. Virol.
68:1360-1370[Abstract/Free Full Text].
|
| 37.
|
Zhang, Y., and B. Moss.
1991.
Inducer-dependent conditional-lethal mutant animal viruses.
Proc. Natl. Acad. Sci. USA
88:1511-1515[Abstract/Free Full Text].
|
J Virol, January 1998, p. 104-112, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Broyles, S. S.
(2003). Vaccinia virus transcription. J. Gen. Virol.
84: 2293-2303
[Abstract]
[Full Text]
-
Heljasvaara, R., Rodriguez, D., Risco, C., Carrascosa, J. L., Esteban, M., Rodriguez, J. R.
(2001). The Major Core Protein P4a (A10L Gene) of Vaccinia Virus Is Essential for Correct Assembly of Viral DNA into the Nucleoprotein Complex To Form Immature Viral Particles. J. Virol.
75: 5778-5795
[Abstract]
[Full Text]
-
Yeh, W. W., Moss, B., Wolffe, E. J.
(2000). The Vaccinia Virus A9L Gene Encodes a Membrane Protein Required for an Early Step in Virion Morphogenesis. J. Virol.
74: 9701-9711
[Abstract]
[Full Text]
-
Traktman, P., Liu, K., DeMasi, J., Rollins, R., Jesty, S., Unger, B.
(2000). Elucidating the Essential Role of the A14 Phosphoprotein in Vaccinia Virus Morphogenesis: Construction and Characterization of a Tetracycline-Inducible Recombinant. J. Virol.
74: 3682-3695
[Abstract]
[Full Text]
-
Lin, C.-L., Chung, C.-S., Heine, H. G., Chang, W.
(2000). Vaccinia Virus Envelope H3L Protein Binds to Cell Surface Heparan Sulfate and Is Important for Intracellular Mature Virion Morphogenesis and Virus Infection In Vitro and In Vivo. J. Virol.
74: 3353-3365
[Abstract]
[Full Text]
-
Broyles, S. S., Liu, X., Zhu, M., Kremer, M.
(1999). Transcription Factor YY1 Is a Vaccinia Virus Late Promoter Activator. J. Biol. Chem.
274: 35662-35667
[Abstract]
[Full Text]
-
Williams, O., Wolffe, E. J., Weisberg, A. S., Merchlinsky, M.
(1999). Vaccinia Virus WR Gene A5L Is Required for Morphogenesis of Mature Virions. J. Virol.
73: 4590-4599
[Abstract]
[Full Text]